\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009514692:

Variant ID: vg1009514692 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9514692
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGCGGGTTATGTTGCTCTTCTCGGATCTCTTGCCTAATCTTGGCCCTCATCGACTCGAGCTTCTCGTCGAATTCAGAGGTCAGCTCCACTCTGATCGA[C/T]
GCCCGGATCTTGGCTTCAAGGCGTGCATCTTTCTCCGCCTTGTTGGAAGTCCGCTTGTCTAGAAATCCATACTTCCAGAGAACGGTGGACCTAATGCCCC

Reverse complement sequence

GGGGCATTAGGTCCACCGTTCTCTGGAAGTATGGATTTCTAGACAAGCGGACTTCCAACAAGGCGGAGAAAGATGCACGCCTTGAAGCCAAGATCCGGGC[G/A]
TCGATCAGAGTGGAGCTGACCTCTGAATTCGACGAGAAGCTCGAGTCGATGAGGGCCAAGATTAGGCAAGAGATCCGAGAAGAGCAACATAACCCGCAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.60% 44.60% 0.72% 5.04% NA
All Indica  2759 71.60% 26.40% 0.62% 1.41% NA
All Japonica  1512 6.30% 86.80% 0.60% 6.28% NA
Aus  269 63.60% 0.70% 2.23% 33.46% NA
Indica I  595 95.10% 3.00% 0.34% 1.51% NA
Indica II  465 76.10% 23.40% 0.22% 0.22% NA
Indica III  913 52.40% 45.90% 0.55% 1.20% NA
Indica Intermediate  786 73.40% 23.20% 1.15% 2.29% NA
Temperate Japonica  767 1.30% 88.80% 0.91% 9.00% NA
Tropical Japonica  504 14.50% 83.90% 0.00% 1.59% NA
Japonica Intermediate  241 5.40% 86.30% 0.83% 7.47% NA
VI/Aromatic  96 63.50% 24.00% 1.04% 11.46% NA
Intermediate  90 46.70% 48.90% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009514692 C -> T LOC_Os10g18720.1 synonymous_variant ; p.Ala162Ala; LOW synonymous_codon Average:48.948; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg1009514692 C -> DEL LOC_Os10g18720.1 N frameshift_variant Average:48.948; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009514692 NA 6.09E-14 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 1.33E-07 2.03E-10 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 7.29E-09 3.74E-10 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 8.74E-10 1.01E-11 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 6.37E-22 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 4.25E-07 1.85E-17 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 9.58E-08 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 1.25E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 1.04E-12 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 1.08E-06 2.48E-09 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 1.27E-06 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 7.12E-32 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 3.27E-11 1.03E-22 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 5.76E-06 1.35E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 1.12E-15 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 2.36E-06 3.24E-10 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 5.65E-07 5.00E-11 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 5.96E-08 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 1.84E-22 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 1.16E-08 4.81E-21 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 5.89E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 3.11E-10 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 1.65E-06 9.11E-15 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 2.72E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 1.04E-09 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 3.30E-06 1.18E-07 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 1.79E-32 mr1495_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 4.15E-12 2.49E-24 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 2.04E-06 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 5.52E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692 NA 4.75E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251