Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009514692:

Variant ID: vg1009514692 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9514692
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

CCTGCGGGTTATGTTGCTCTTCTCGGATCTCTTGCCTAATCTTGGCCCTCATCGACTCGAGCTTCTCGTCGAATTCAGAGGTCAGCTCCACTCTGATCGA[C/T]
GCCCGGATCTTGGCTTCAAGGCGTGCATCTTTCTCCGCCTTGTTGGAAGTCCGCTTGTCTAGAAATCCATACTTCCAGAGAACGGTGGACCTAATGCCCC

Reverse complement sequence

GGGGCATTAGGTCCACCGTTCTCTGGAAGTATGGATTTCTAGACAAGCGGACTTCCAACAAGGCGGAGAAAGATGCACGCCTTGAAGCCAAGATCCGGGC[G/A]
TCGATCAGAGTGGAGCTGACCTCTGAATTCGACGAGAAGCTCGAGTCGATGAGGGCCAAGATTAGGCAAGAGATCCGAGAAGAGCAACATAACCCGCAGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.60%	44.60%	0.72%	5.04%	NA
All Indica	2759	71.60%	26.40%	0.62%	1.41%	NA
All Japonica	1512	6.30%	86.80%	0.60%	6.28%	NA
Aus	269	63.60%	0.70%	2.23%	33.46%	NA
Indica I	595	95.10%	3.00%	0.34%	1.51%	NA
Indica II	465	76.10%	23.40%	0.22%	0.22%	NA
Indica III	913	52.40%	45.90%	0.55%	1.20%	NA
Indica Intermediate	786	73.40%	23.20%	1.15%	2.29%	NA
Temperate Japonica	767	1.30%	88.80%	0.91%	9.00%	NA
Tropical Japonica	504	14.50%	83.90%	0.00%	1.59%	NA
Japonica Intermediate	241	5.40%	86.30%	0.83%	7.47%	NA
VI/Aromatic	96	63.50%	24.00%	1.04%	11.46%	NA
Intermediate	90	46.70%	48.90%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009514692	C -> T	LOC_Os10g18720.1	synonymous_variant ; p.Ala162Ala; LOW	synonymous_codon	Average:48.948; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg1009514692	C -> DEL	LOC_Os10g18720.1	N	frameshift_variant	Average:48.948; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009514692	NA	6.09E-14	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	1.33E-07	2.03E-10	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	7.29E-09	3.74E-10	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	8.74E-10	1.01E-11	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	6.37E-22	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	4.25E-07	1.85E-17	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	9.58E-08	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	1.25E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	1.04E-12	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	1.08E-06	2.48E-09	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	1.27E-06	mr1261	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	7.12E-32	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	3.27E-11	1.03E-22	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	5.76E-06	1.35E-08	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	1.12E-15	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	2.36E-06	3.24E-10	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	5.65E-07	5.00E-11	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	5.96E-08	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	1.84E-22	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	1.16E-08	4.81E-21	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	5.89E-08	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	3.11E-10	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	1.65E-06	9.11E-15	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	2.72E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	1.04E-09	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	3.30E-06	1.18E-07	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	1.79E-32	mr1495_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	4.15E-12	2.49E-24	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	2.04E-06	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	5.52E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009514692	NA	4.75E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251