\
| Variant ID: vg1009512226 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9512226 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 90. )
CCTAAACTAGAGCACGTCACATATGATACTCATCTCAATTGGGCCTAAACTATAGCCCGCCACAGATGACCATCATCTCAATCAGGCATTAACTACATCC[C/T]
GTCATAGATGACCCTCATCTCAATCTGGCACTAAGTTATGGCCAGTCACATATGAGTATAATTCACAAAAAATAAATTTTGTTTTTTGGCTAGCCTCTAG
CTAGAGGCTAGCCAAAAAACAAAATTTATTTTTTGTGAATTATACTCATATGTGACTGGCCATAACTTAGTGCCAGATTGAGATGAGGGTCATCTATGAC[G/A]
GGATGTAGTTAATGCCTGATTGAGATGATGGTCATCTGTGGCGGGCTATAGTTTAGGCCCAATTGAGATGAGTATCATATGTGACGTGCTCTAGTTTAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.90% | 21.50% | 0.34% | 6.26% | NA |
| All Indica | 2759 | 73.60% | 24.30% | 0.25% | 1.81% | NA |
| All Japonica | 1512 | 70.10% | 20.40% | 0.33% | 9.13% | NA |
| Aus | 269 | 64.30% | 0.40% | 1.12% | 34.20% | NA |
| Indica I | 595 | 97.30% | 1.30% | 0.00% | 1.34% | NA |
| Indica II | 465 | 77.60% | 21.90% | 0.22% | 0.22% | NA |
| Indica III | 913 | 54.50% | 43.60% | 0.22% | 1.64% | NA |
| Indica Intermediate | 786 | 75.40% | 20.70% | 0.51% | 3.31% | NA |
| Temperate Japonica | 767 | 84.10% | 5.00% | 0.65% | 10.30% | NA |
| Tropical Japonica | 504 | 57.70% | 40.10% | 0.00% | 2.18% | NA |
| Japonica Intermediate | 241 | 51.50% | 28.60% | 0.00% | 19.92% | NA |
| VI/Aromatic | 96 | 63.50% | 21.90% | 1.04% | 13.54% | NA |
| Intermediate | 90 | 80.00% | 16.70% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009512226 | C -> T | LOC_Os10g18704.1 | upstream_gene_variant ; 4780.0bp to feature; MODIFIER | silent_mutation | Average:46.533; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
| vg1009512226 | C -> T | LOC_Os10g18710.1 | downstream_gene_variant ; 408.0bp to feature; MODIFIER | silent_mutation | Average:46.533; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
| vg1009512226 | C -> T | LOC_Os10g18720.1 | downstream_gene_variant ; 1678.0bp to feature; MODIFIER | silent_mutation | Average:46.533; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
| vg1009512226 | C -> T | LOC_Os10g18704-LOC_Os10g18710 | intergenic_region ; MODIFIER | silent_mutation | Average:46.533; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
| vg1009512226 | C -> DEL | N | N | silent_mutation | Average:46.533; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009512226 | NA | 1.44E-07 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1009512226 | NA | 2.24E-12 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 5.06E-08 | NA | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 1.52E-07 | 8.68E-12 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 4.09E-08 | NA | mr1114 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 2.85E-08 | 1.13E-11 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 5.26E-08 | NA | mr1116 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 2.60E-08 | 2.50E-12 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 7.59E-06 | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 8.05E-06 | 1.48E-21 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 3.03E-12 | 1.11E-23 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 3.39E-06 | NA | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 2.48E-09 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 8.35E-06 | 8.18E-08 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 4.85E-06 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 3.39E-12 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 1.58E-13 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 2.16E-10 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 6.16E-06 | NA | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 3.80E-08 | 1.34E-11 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 1.79E-06 | 1.89E-25 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 4.73E-12 | 3.31E-27 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 1.67E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 2.19E-13 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 1.14E-09 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 1.01E-07 | 3.35E-15 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 6.66E-07 | 6.20E-13 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 8.42E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 7.30E-06 | 1.67E-07 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 2.47E-07 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 6.00E-08 | 4.41E-14 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 5.02E-08 | 1.02E-14 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 5.16E-07 | 1.22E-11 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 1.96E-19 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 1.15E-09 | 1.09E-22 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 9.15E-07 | 3.47E-11 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 5.83E-08 | 1.55E-14 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 3.17E-06 | 1.16E-11 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 2.11E-08 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 2.19E-07 | 2.02E-13 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 2.98E-09 | NA | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 9.42E-08 | 1.12E-09 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 1.60E-07 | 2.80E-25 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 1.18E-10 | 8.65E-26 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 1.47E-09 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 6.16E-07 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 1.45E-07 | 3.99E-20 | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 2.83E-16 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 4.00E-06 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 7.89E-07 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 8.02E-07 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 8.60E-06 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | 2.88E-06 | NA | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009512226 | NA | 1.12E-06 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |