\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009512226:

Variant ID: vg1009512226 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9512226
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAAACTAGAGCACGTCACATATGATACTCATCTCAATTGGGCCTAAACTATAGCCCGCCACAGATGACCATCATCTCAATCAGGCATTAACTACATCC[C/T]
GTCATAGATGACCCTCATCTCAATCTGGCACTAAGTTATGGCCAGTCACATATGAGTATAATTCACAAAAAATAAATTTTGTTTTTTGGCTAGCCTCTAG

Reverse complement sequence

CTAGAGGCTAGCCAAAAAACAAAATTTATTTTTTGTGAATTATACTCATATGTGACTGGCCATAACTTAGTGCCAGATTGAGATGAGGGTCATCTATGAC[G/A]
GGATGTAGTTAATGCCTGATTGAGATGATGGTCATCTGTGGCGGGCTATAGTTTAGGCCCAATTGAGATGAGTATCATATGTGACGTGCTCTAGTTTAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.90% 21.50% 0.34% 6.26% NA
All Indica  2759 73.60% 24.30% 0.25% 1.81% NA
All Japonica  1512 70.10% 20.40% 0.33% 9.13% NA
Aus  269 64.30% 0.40% 1.12% 34.20% NA
Indica I  595 97.30% 1.30% 0.00% 1.34% NA
Indica II  465 77.60% 21.90% 0.22% 0.22% NA
Indica III  913 54.50% 43.60% 0.22% 1.64% NA
Indica Intermediate  786 75.40% 20.70% 0.51% 3.31% NA
Temperate Japonica  767 84.10% 5.00% 0.65% 10.30% NA
Tropical Japonica  504 57.70% 40.10% 0.00% 2.18% NA
Japonica Intermediate  241 51.50% 28.60% 0.00% 19.92% NA
VI/Aromatic  96 63.50% 21.90% 1.04% 13.54% NA
Intermediate  90 80.00% 16.70% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009512226 C -> T LOC_Os10g18704.1 upstream_gene_variant ; 4780.0bp to feature; MODIFIER silent_mutation Average:46.533; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg1009512226 C -> T LOC_Os10g18710.1 downstream_gene_variant ; 408.0bp to feature; MODIFIER silent_mutation Average:46.533; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg1009512226 C -> T LOC_Os10g18720.1 downstream_gene_variant ; 1678.0bp to feature; MODIFIER silent_mutation Average:46.533; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg1009512226 C -> T LOC_Os10g18704-LOC_Os10g18710 intergenic_region ; MODIFIER silent_mutation Average:46.533; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg1009512226 C -> DEL N N silent_mutation Average:46.533; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009512226 NA 1.44E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1009512226 NA 2.24E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 5.06E-08 NA mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 1.52E-07 8.68E-12 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 4.09E-08 NA mr1114 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 2.85E-08 1.13E-11 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 5.26E-08 NA mr1116 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 2.60E-08 2.50E-12 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 7.59E-06 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 8.05E-06 1.48E-21 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 3.03E-12 1.11E-23 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 3.39E-06 NA mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 2.48E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 8.35E-06 8.18E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 4.85E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 3.39E-12 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 1.58E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 2.16E-10 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 6.16E-06 NA mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 3.80E-08 1.34E-11 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 1.79E-06 1.89E-25 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 4.73E-12 3.31E-27 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 1.67E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 2.19E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 1.14E-09 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 1.01E-07 3.35E-15 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 6.66E-07 6.20E-13 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 8.42E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 7.30E-06 1.67E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 2.47E-07 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 6.00E-08 4.41E-14 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 5.02E-08 1.02E-14 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 5.16E-07 1.22E-11 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 1.96E-19 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 1.15E-09 1.09E-22 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 9.15E-07 3.47E-11 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 5.83E-08 1.55E-14 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 3.17E-06 1.16E-11 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 2.11E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 2.19E-07 2.02E-13 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 2.98E-09 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 9.42E-08 1.12E-09 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 1.60E-07 2.80E-25 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 1.18E-10 8.65E-26 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 1.47E-09 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 6.16E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 1.45E-07 3.99E-20 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 2.83E-16 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 4.00E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 7.89E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 8.02E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 8.60E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 2.88E-06 NA mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009512226 NA 1.12E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251