\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009498741:

Variant ID: vg1009498741 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9498741
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACCAAAGGTTGAGATTCATGGAGCATATGAACTTTGGTTCATATATGCTTAGACCTATATGTACGTGTGTGTATATAGAGAGTAGCTCTATTATACACC[C/T]
CTTCCTTAGAATAACTATTCTACGCCCCTCTCCCACCTTCCATCTGTCCCTCCCGAAGTCTCAATCTCTCATCCCCCAATCTCTCCTTTTCTTCTTTTTT

Reverse complement sequence

AAAAAAGAAGAAAAGGAGAGATTGGGGGATGAGAGATTGAGACTTCGGGAGGGACAGATGGAAGGTGGGAGAGGGGCGTAGAATAGTTATTCTAAGGAAG[G/A]
GGTGTATAATAGAGCTACTCTCTATATACACACACGTACATATAGGTCTAAGCATATATGAACCAAAGTTCATATGCTCCATGAATCTCAACCTTTGGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 29.50% 3.89% 15.40% NA
All Indica  2759 67.50% 11.90% 6.31% 14.28% NA
All Japonica  1512 13.40% 65.40% 0.53% 20.70% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 85.40% 2.50% 5.21% 6.89% NA
Indica II  465 74.20% 8.80% 5.16% 11.83% NA
Indica III  913 48.70% 22.70% 7.23% 21.36% NA
Indica Intermediate  786 71.80% 8.40% 6.74% 13.10% NA
Temperate Japonica  767 1.30% 83.20% 0.26% 15.25% NA
Tropical Japonica  504 32.70% 47.60% 0.60% 19.05% NA
Japonica Intermediate  241 11.20% 46.10% 1.24% 41.49% NA
VI/Aromatic  96 44.80% 40.60% 0.00% 14.58% NA
Intermediate  90 50.00% 41.10% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009498741 C -> T LOC_Os10g18700.1 upstream_gene_variant ; 3057.0bp to feature; MODIFIER silent_mutation Average:53.729; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg1009498741 C -> T LOC_Os10g18670-LOC_Os10g18700 intergenic_region ; MODIFIER silent_mutation Average:53.729; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N
vg1009498741 C -> DEL N N silent_mutation Average:53.729; most accessible tissue: Zhenshan97 root, score: 91.073 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1009498741 C T 0.02 0.01 0.06 -0.04 0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009498741 NA 1.08E-25 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009498741 NA 1.87E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009498741 NA 7.75E-23 mr1841 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009498741 NA 3.16E-14 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009498741 NA 5.80E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009498741 NA 9.79E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009498741 NA 4.56E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251