\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009471877:

Variant ID: vg1009471877 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9471877
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.36, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CTATTTACACATCATATGGTTGCTAGGTGCAGTACACTAAGGGTGTGTTTGAGGAGAAGGGGATTAAGGAGATTGAAAAGATACGTAAAACGAGGTAAGC[T/C]
ATTAGCTCATAATTAATTGAGTATTAACTATTTTAAATTTTAAAAATAGATTAATATGATTTTTTAAAGCAACTTTTCTATAGAACCGTTTTTGCAAAAA

Reverse complement sequence

TTTTTGCAAAAACGGTTCTATAGAAAAGTTGCTTTAAAAAATCATATTAATCTATTTTTAAAATTTAAAATAGTTAATACTCAATTAATTATGAGCTAAT[A/G]
GCTTACCTCGTTTTACGTATCTTTTCAATCTCCTTAATCCCCTTCTCCTCAAACACACCCTTAGTGTACTGCACCTAGCAACCATATGATGTGTAAATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.60% 13.00% 0.28% 52.16% NA
All Indica  2759 34.40% 2.10% 0.29% 63.21% NA
All Japonica  1512 23.10% 35.70% 0.26% 40.94% NA
Aus  269 97.00% 0.40% 0.00% 2.60% NA
Indica I  595 71.10% 3.20% 0.17% 25.55% NA
Indica II  465 17.80% 2.20% 0.22% 79.78% NA
Indica III  913 18.00% 0.80% 0.22% 81.05% NA
Indica Intermediate  786 35.40% 2.90% 0.51% 61.20% NA
Temperate Japonica  767 24.00% 54.40% 0.13% 21.51% NA
Tropical Japonica  504 27.00% 7.70% 0.20% 65.08% NA
Japonica Intermediate  241 12.00% 34.90% 0.83% 52.28% NA
VI/Aromatic  96 43.80% 0.00% 0.00% 56.25% NA
Intermediate  90 38.90% 14.40% 1.11% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009471877 T -> C LOC_Os10g18660.1 upstream_gene_variant ; 3006.0bp to feature; MODIFIER silent_mutation Average:74.567; most accessible tissue: Zhenshan97 flag leaf, score: 91.854 N N N N
vg1009471877 T -> C LOC_Os10g18660-LOC_Os10g18670 intergenic_region ; MODIFIER silent_mutation Average:74.567; most accessible tissue: Zhenshan97 flag leaf, score: 91.854 N N N N
vg1009471877 T -> DEL N N silent_mutation Average:74.567; most accessible tissue: Zhenshan97 flag leaf, score: 91.854 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1009471877 T C 0.0 0.0 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009471877 3.25E-06 9.54E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009471877 6.01E-06 NA mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009471877 6.76E-07 5.13E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009471877 2.36E-06 NA mr1204 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009471877 NA 5.84E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009471877 NA 2.58E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251