\
| Variant ID: vg1009470579 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9470579 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATGTATGTGGGCAATACTAGAAAGCCTTACGTTATAAAACGGAGGGAGTACTTGATTTGATCGGGTATATATACCCATTTGATTTTTCGTATACTCATT[T/A]
AAATTGGGTATATGACCAATTAAATTTTTATACTCACATATCGGGTATGTCTATTTAAAAACAAATTAAATACCATCAAAACACTTATTTTGGGTAAAAA
TTTTTACCCAAAATAAGTGTTTTGATGGTATTTAATTTGTTTTTAAATAGACATACCCGATATGTGAGTATAAAAATTTAATTGGTCATATACCCAATTT[A/T]
AATGAGTATACGAAAAATCAAATGGGTATATATACCCGATCAAATCAAGTACTCCCTCCGTTTTATAACGTAAGGCTTTCTAGTATTGCCCACATACATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 4.90% | 0.11% | 20.50% | NA |
| All Indica | 2759 | 75.70% | 1.20% | 0.07% | 23.02% | NA |
| All Japonica | 1512 | 78.90% | 0.30% | 0.13% | 20.63% | NA |
| Aus | 269 | 38.70% | 61.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 98.70% | 0.00% | 0.00% | 1.34% | NA |
| Indica II | 465 | 78.90% | 0.90% | 0.00% | 20.22% | NA |
| Indica III | 913 | 56.50% | 0.50% | 0.11% | 42.83% | NA |
| Indica Intermediate | 786 | 78.60% | 3.20% | 0.13% | 18.07% | NA |
| Temperate Japonica | 767 | 84.90% | 0.00% | 0.13% | 14.99% | NA |
| Tropical Japonica | 504 | 81.00% | 0.00% | 0.00% | 19.05% | NA |
| Japonica Intermediate | 241 | 55.60% | 2.10% | 0.41% | 41.91% | NA |
| VI/Aromatic | 96 | 64.60% | 20.80% | 1.04% | 13.54% | NA |
| Intermediate | 90 | 80.00% | 11.10% | 0.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009470579 | T -> A | LOC_Os10g18660.1 | upstream_gene_variant ; 1708.0bp to feature; MODIFIER | silent_mutation | Average:14.555; most accessible tissue: Callus, score: 27.709 | N | N | N | N |
| vg1009470579 | T -> A | LOC_Os10g18660-LOC_Os10g18670 | intergenic_region ; MODIFIER | silent_mutation | Average:14.555; most accessible tissue: Callus, score: 27.709 | N | N | N | N |
| vg1009470579 | T -> DEL | N | N | silent_mutation | Average:14.555; most accessible tissue: Callus, score: 27.709 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009470579 | NA | 2.25E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009470579 | NA | 2.95E-15 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009470579 | NA | 1.05E-09 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009470579 | 8.99E-09 | NA | mr1024_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009470579 | NA | 1.34E-11 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009470579 | 9.20E-07 | 4.23E-08 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009470579 | NA | 4.75E-08 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |