Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009451061:

Variant ID: vg1009451061 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9451061
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.15, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTCAAGCATATCGGCTTTACATCTCCTCGGAGTTTGCTGGCGCGGTCTAACCCCTGGCTTGATAGCTAGCCGATGTTCAACAATCGATCGGCTGAGTC[T/C]
AGGCATCTCATAATACTCCCAAGCGAAGCAATCTCTAAACTCTTTTAAGAGCTCTATCAGCTTGGTTCTAAACTCTGGAGACAAATTCTTGCTAATAAAT

Reverse complement sequence

ATTTATTAGCAAGAATTTGTCTCCAGAGTTTAGAACCAAGCTGATAGAGCTCTTAAAAGAGTTTAGAGATTGCTTCGCTTGGGAGTATTATGAGATGCCT[A/G]
GACTCAGCCGATCGATTGTTGAACATCGGCTAGCTATCAAGCCAGGGGTTAGACCGCGCCAGCAAACTCCGAGGAGATGTAAAGCCGATATGCTTGAACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.50%	12.30%	7.34%	51.90%	NA
All Indica	2759	21.00%	1.10%	11.49%	66.47%	NA
All Japonica	1512	26.00%	35.30%	1.12%	37.57%	NA
Aus	269	96.70%	0.00%	1.12%	2.23%	NA
Indica I	595	34.50%	1.30%	31.26%	32.94%	NA
Indica II	465	10.80%	1.50%	4.73%	83.01%	NA
Indica III	913	15.30%	0.70%	4.05%	79.96%	NA
Indica Intermediate	786	23.40%	1.00%	9.16%	66.41%	NA
Temperate Japonica	767	7.00%	54.50%	1.30%	37.16%	NA
Tropical Japonica	504	58.10%	7.10%	1.19%	33.53%	NA
Japonica Intermediate	241	19.10%	33.20%	0.41%	47.30%	NA
VI/Aromatic	96	80.20%	0.00%	4.17%	15.62%	NA
Intermediate	90	41.10%	18.90%	6.67%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009451061	T -> C	LOC_Os10g18620.1	upstream_gene_variant ; 4867.0bp to feature; MODIFIER	silent_mutation	Average:18.185; most accessible tissue: Callus, score: 40.929	N	N	N	N
vg1009451061	T -> C	LOC_Os10g18630.1	downstream_gene_variant ; 607.0bp to feature; MODIFIER	silent_mutation	Average:18.185; most accessible tissue: Callus, score: 40.929	N	N	N	N
vg1009451061	T -> C	LOC_Os10g18640.1	downstream_gene_variant ; 172.0bp to feature; MODIFIER	silent_mutation	Average:18.185; most accessible tissue: Callus, score: 40.929	N	N	N	N
vg1009451061	T -> C	LOC_Os10g18650.1	downstream_gene_variant ; 4303.0bp to feature; MODIFIER	silent_mutation	Average:18.185; most accessible tissue: Callus, score: 40.929	N	N	N	N
vg1009451061	T -> C	LOC_Os10g18630-LOC_Os10g18640	intergenic_region ; MODIFIER	silent_mutation	Average:18.185; most accessible tissue: Callus, score: 40.929	N	N	N	N
vg1009451061	T -> DEL	N	N	silent_mutation	Average:18.185; most accessible tissue: Callus, score: 40.929	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009451061	5.86E-07	2.21E-06	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	1.15E-06	NA	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	1.62E-09	1.06E-08	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	1.26E-06	8.85E-06	mr1147	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	5.65E-06	NA	mr1152	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	NA	6.22E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	NA	1.10E-06	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	NA	9.68E-07	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	NA	1.10E-06	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	2.67E-06	NA	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	NA	9.29E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	3.02E-06	NA	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	NA	6.33E-07	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	NA	1.03E-07	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009451061	NA	3.55E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251