\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009450795:

Variant ID: vg1009450795 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9450795
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, A: 0.15, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


CTCAAAGATTGGTTCTGTAGCTTCTATGAAGGCTTTCAAAAAGATGCACGAGTTTGGTTCCTTTATGAAGATTCTGCAGAACTTGAGCACCTACTGGACT[T/A]
CAGATTCGAAGACATCAACCACGAAATATACCAATCGTCCAGGGAGATTTTCTCAGCTGCAATCAGCCCATGCATCCTTCCTGTTGGCATTCATCAAGGA

Reverse complement sequence

TCCTTGATGAATGCCAACAGGAAGGATGCATGGGCTGATTGCAGCTGAGAAAATCTCCCTGGACGATTGGTATATTTCGTGGTTGATGTCTTCGAATCTG[A/T]
AGTCCAGTAGGTGCTCAAGTTCTGCAGAATCTTCATAAAGGAACCAAACTCGTGCATCTTTTTGAAAGCCTTCATAGAAGCTACAGAACCAATCTTTGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.80% 29.80% 0.76% 24.65% NA
All Indica  2759 42.10% 33.60% 1.12% 23.16% NA
All Japonica  1512 56.50% 10.00% 0.26% 33.20% NA
Aus  269 2.20% 97.40% 0.00% 0.37% NA
Indica I  595 27.20% 70.30% 0.84% 1.68% NA
Indica II  465 60.60% 17.20% 1.08% 21.08% NA
Indica III  913 39.10% 17.60% 0.99% 42.28% NA
Indica Intermediate  786 45.80% 34.20% 1.53% 18.45% NA
Temperate Japonica  767 61.90% 1.40% 0.39% 36.25% NA
Tropical Japonica  504 53.80% 23.20% 0.20% 22.82% NA
Japonica Intermediate  241 45.20% 9.50% 0.00% 45.23% NA
VI/Aromatic  96 42.70% 43.80% 0.00% 13.54% NA
Intermediate  90 57.80% 30.00% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009450795 T -> A LOC_Os10g18620.1 upstream_gene_variant ; 4601.0bp to feature; MODIFIER silent_mutation Average:20.981; most accessible tissue: Callus, score: 52.935 N N N N
vg1009450795 T -> A LOC_Os10g18630.1 downstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:20.981; most accessible tissue: Callus, score: 52.935 N N N N
vg1009450795 T -> A LOC_Os10g18640.1 downstream_gene_variant ; 438.0bp to feature; MODIFIER silent_mutation Average:20.981; most accessible tissue: Callus, score: 52.935 N N N N
vg1009450795 T -> A LOC_Os10g18650.1 downstream_gene_variant ; 4569.0bp to feature; MODIFIER silent_mutation Average:20.981; most accessible tissue: Callus, score: 52.935 N N N N
vg1009450795 T -> A LOC_Os10g18630-LOC_Os10g18640 intergenic_region ; MODIFIER silent_mutation Average:20.981; most accessible tissue: Callus, score: 52.935 N N N N
vg1009450795 T -> DEL N N silent_mutation Average:20.981; most accessible tissue: Callus, score: 52.935 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009450795 3.07E-06 NA mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 3.69E-06 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 2.34E-07 1.93E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 3.18E-06 NA mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 NA 1.88E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 2.45E-06 NA mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 5.96E-08 1.50E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 2.70E-06 NA mr1070_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 2.84E-06 NA mr1128_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 5.08E-06 NA mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 1.62E-06 NA mr1147_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 2.34E-07 4.15E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 8.91E-06 NA mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 8.23E-06 NA mr1437_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 NA 5.01E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 NA 5.29E-08 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795 NA 8.98E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251