Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009450795:

Variant ID: vg1009450795 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9450795
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, A: 0.15, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

CTCAAAGATTGGTTCTGTAGCTTCTATGAAGGCTTTCAAAAAGATGCACGAGTTTGGTTCCTTTATGAAGATTCTGCAGAACTTGAGCACCTACTGGACT[T/A]
CAGATTCGAAGACATCAACCACGAAATATACCAATCGTCCAGGGAGATTTTCTCAGCTGCAATCAGCCCATGCATCCTTCCTGTTGGCATTCATCAAGGA

Reverse complement sequence

TCCTTGATGAATGCCAACAGGAAGGATGCATGGGCTGATTGCAGCTGAGAAAATCTCCCTGGACGATTGGTATATTTCGTGGTTGATGTCTTCGAATCTG[A/T]
AGTCCAGTAGGTGCTCAAGTTCTGCAGAATCTTCATAAAGGAACCAAACTCGTGCATCTTTTTGAAAGCCTTCATAGAAGCTACAGAACCAATCTTTGAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.80%	29.80%	0.76%	24.65%	NA
All Indica	2759	42.10%	33.60%	1.12%	23.16%	NA
All Japonica	1512	56.50%	10.00%	0.26%	33.20%	NA
Aus	269	2.20%	97.40%	0.00%	0.37%	NA
Indica I	595	27.20%	70.30%	0.84%	1.68%	NA
Indica II	465	60.60%	17.20%	1.08%	21.08%	NA
Indica III	913	39.10%	17.60%	0.99%	42.28%	NA
Indica Intermediate	786	45.80%	34.20%	1.53%	18.45%	NA
Temperate Japonica	767	61.90%	1.40%	0.39%	36.25%	NA
Tropical Japonica	504	53.80%	23.20%	0.20%	22.82%	NA
Japonica Intermediate	241	45.20%	9.50%	0.00%	45.23%	NA
VI/Aromatic	96	42.70%	43.80%	0.00%	13.54%	NA
Intermediate	90	57.80%	30.00%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009450795	T -> A	LOC_Os10g18620.1	upstream_gene_variant ; 4601.0bp to feature; MODIFIER	silent_mutation	Average:20.981; most accessible tissue: Callus, score: 52.935	N	N	N	N
vg1009450795	T -> A	LOC_Os10g18630.1	downstream_gene_variant ; 341.0bp to feature; MODIFIER	silent_mutation	Average:20.981; most accessible tissue: Callus, score: 52.935	N	N	N	N
vg1009450795	T -> A	LOC_Os10g18640.1	downstream_gene_variant ; 438.0bp to feature; MODIFIER	silent_mutation	Average:20.981; most accessible tissue: Callus, score: 52.935	N	N	N	N
vg1009450795	T -> A	LOC_Os10g18650.1	downstream_gene_variant ; 4569.0bp to feature; MODIFIER	silent_mutation	Average:20.981; most accessible tissue: Callus, score: 52.935	N	N	N	N
vg1009450795	T -> A	LOC_Os10g18630-LOC_Os10g18640	intergenic_region ; MODIFIER	silent_mutation	Average:20.981; most accessible tissue: Callus, score: 52.935	N	N	N	N
vg1009450795	T -> DEL	N	N	silent_mutation	Average:20.981; most accessible tissue: Callus, score: 52.935	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009450795	3.07E-06	NA	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	3.69E-06	NA	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	2.34E-07	1.93E-06	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	3.18E-06	NA	mr1147	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	NA	1.88E-07	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	2.45E-06	NA	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	5.96E-08	1.50E-07	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	2.70E-06	NA	mr1070_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	2.84E-06	NA	mr1128_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	5.08E-06	NA	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	1.62E-06	NA	mr1147_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	2.34E-07	4.15E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	8.91E-06	NA	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	8.23E-06	NA	mr1437_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	NA	5.01E-06	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	NA	5.29E-08	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450795	NA	8.98E-06	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251