\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009450763:

Variant ID: vg1009450763 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9450763
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.04, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


CCGATGCTGGGGCAAAACTTTCGGCTGAACTGCTCAAAGATTGGTTCTGTAGCTTCTATGAAGGCTTTCAAAAAGATGCACGAGTTTGGTTCCTTTATGA[A/T]
GATTCTGCAGAACTTGAGCACCTACTGGACTTCAGATTCGAAGACATCAACCACGAAATATACCAATCGTCCAGGGAGATTTTCTCAGCTGCAATCAGCC

Reverse complement sequence

GGCTGATTGCAGCTGAGAAAATCTCCCTGGACGATTGGTATATTTCGTGGTTGATGTCTTCGAATCTGAAGTCCAGTAGGTGCTCAAGTTCTGCAGAATC[T/A]
TCATAAAGGAACCAAACTCGTGCATCTTTTTGAAAGCCTTCATAGAAGCTACAGAACCAATCTTTGAGCAGTTCAGCCGAAAGTTTTGCCCCAGCATCGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 24.80% 0.59% 24.95% NA
All Indica  2759 43.30% 32.30% 0.91% 23.52% NA
All Japonica  1512 56.90% 9.60% 0.13% 33.40% NA
Aus  269 63.20% 36.40% 0.00% 0.37% NA
Indica I  595 26.90% 70.80% 0.67% 1.68% NA
Indica II  465 61.90% 15.90% 0.86% 21.29% NA
Indica III  913 39.80% 16.90% 0.66% 42.72% NA
Indica Intermediate  786 48.90% 30.70% 1.40% 19.08% NA
Temperate Japonica  767 62.10% 1.30% 0.26% 36.38% NA
Tropical Japonica  504 53.60% 23.20% 0.00% 23.21% NA
Japonica Intermediate  241 47.30% 7.50% 0.00% 45.23% NA
VI/Aromatic  96 63.50% 22.90% 0.00% 13.54% NA
Intermediate  90 67.80% 18.90% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009450763 A -> T LOC_Os10g18620.1 upstream_gene_variant ; 4569.0bp to feature; MODIFIER silent_mutation Average:21.396; most accessible tissue: Callus, score: 52.935 N N N N
vg1009450763 A -> T LOC_Os10g18630.1 downstream_gene_variant ; 309.0bp to feature; MODIFIER silent_mutation Average:21.396; most accessible tissue: Callus, score: 52.935 N N N N
vg1009450763 A -> T LOC_Os10g18640.1 downstream_gene_variant ; 470.0bp to feature; MODIFIER silent_mutation Average:21.396; most accessible tissue: Callus, score: 52.935 N N N N
vg1009450763 A -> T LOC_Os10g18650.1 downstream_gene_variant ; 4601.0bp to feature; MODIFIER silent_mutation Average:21.396; most accessible tissue: Callus, score: 52.935 N N N N
vg1009450763 A -> T LOC_Os10g18630-LOC_Os10g18640 intergenic_region ; MODIFIER silent_mutation Average:21.396; most accessible tissue: Callus, score: 52.935 N N N N
vg1009450763 A -> DEL N N silent_mutation Average:21.396; most accessible tissue: Callus, score: 52.935 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009450763 6.45E-08 2.30E-07 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 2.50E-06 NA mr1076 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 1.08E-07 4.95E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 1.11E-06 4.76E-06 mr1139 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 8.44E-06 3.75E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 4.02E-07 1.49E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 2.56E-06 4.75E-06 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 4.12E-06 NA mr1436 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 3.64E-07 2.18E-06 mr1437 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 NA 3.64E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 NA 5.07E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 NA 3.39E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 1.40E-08 1.23E-08 mr1053_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 1.22E-07 NA mr1070_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 1.46E-06 NA mr1076_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 NA 1.54E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 8.02E-07 4.26E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 6.46E-06 NA mr1145_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 7.83E-08 3.93E-07 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 3.65E-06 3.65E-06 mr1250_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 1.93E-06 4.76E-06 mr1264_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 1.05E-06 NA mr1437_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 NA 1.68E-10 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 NA 1.27E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009450763 NA 3.96E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251