\
| Variant ID: vg1009415346 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9415346 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 80. )
TGGATTACCACCAAAGTCTTTGAGCACCATATTTGTCTTGATGAGATCCTCAGCGTTCCTACCCAGCTTCCTGAACGTAGCATAAGGCATCAAGTTCACC[G/A]
CGGCCCCACCATCGACCATCATCTTAGACAACGGCTTCCCATTTACGTAGCCGTTTATATACAATGGTTTAAGATGTCGATTCTCTGTCCCCTCGGGTTT
AAACCCGAGGGGACAGAGAATCGACATCTTAAACCATTGTATATAAACGGCTACGTAAATGGGAAGCCGTTGTCTAAGATGATGGTCGATGGTGGGGCCG[C/T]
GGTGAACTTGATGCCTTATGCTACGTTCAGGAAGCTGGGTAGGAACGCTGAGGATCTCATCAAGACAAATATGGTGCTCAAAGACTTTGGTGGTAATCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.00% | 0.50% | 20.91% | 41.56% | NA |
| All Indica | 2759 | 38.10% | 0.70% | 24.07% | 37.11% | NA |
| All Japonica | 1512 | 39.80% | 0.10% | 3.17% | 56.94% | NA |
| Aus | 269 | 5.60% | 1.50% | 87.36% | 5.58% | NA |
| Indica I | 595 | 25.50% | 1.00% | 16.97% | 56.47% | NA |
| Indica II | 465 | 56.30% | 0.90% | 16.13% | 26.67% | NA |
| Indica III | 913 | 33.80% | 0.20% | 33.95% | 31.98% | NA |
| Indica Intermediate | 786 | 41.90% | 0.90% | 22.65% | 34.61% | NA |
| Temperate Japonica | 767 | 55.70% | 0.00% | 0.91% | 43.42% | NA |
| Tropical Japonica | 504 | 17.30% | 0.20% | 5.56% | 76.98% | NA |
| Japonica Intermediate | 241 | 36.50% | 0.00% | 5.39% | 58.09% | NA |
| VI/Aromatic | 96 | 42.70% | 1.00% | 20.83% | 35.42% | NA |
| Intermediate | 90 | 43.30% | 0.00% | 23.33% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009415346 | G -> A | LOC_Os10g18560.1 | missense_variant ; p.Ala142Val; MODERATE | nonsynonymous_codon ; A142V | Average:19.116; most accessible tissue: Minghui63 young leaf, score: 28.65 | benign |
0.652 |
TOLERATED | 0.08 |
| vg1009415346 | G -> DEL | LOC_Os10g18560.1 | N | frameshift_variant | Average:19.116; most accessible tissue: Minghui63 young leaf, score: 28.65 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009415346 | 6.82E-06 | 3.08E-06 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | NA | 1.33E-06 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | NA | 3.62E-07 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | NA | 3.10E-08 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | 3.48E-08 | 7.32E-09 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | 2.81E-06 | NA | mr1070_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | 5.93E-06 | NA | mr1076_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | NA | 1.15E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | 5.21E-06 | 9.75E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | 6.01E-06 | NA | mr1145_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | 2.93E-08 | 5.24E-08 | mr1147_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | 3.60E-06 | 3.60E-06 | mr1250_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | 2.13E-06 | 1.67E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | NA | 1.73E-10 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009415346 | NA | 2.31E-06 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |