\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009414426:

Variant ID: vg1009414426 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 9414426
Reference Allele: GAlternative Allele: A,GA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TCCATAAAACTCAAAATTTTGTTCCCTGATGCGGCGTCAACCAGCTGATCGGCTACTGGCATTGGATATTCGTCCTTTGGTGTAGCTTTATTCAAATCTC[G/A,GA]
AAAATCAATGCACACCCTGACCTTGCCATTCTTTTTAATAACTGGACTATGCTAGAAACCCATTCGGCACATCGGCAGGGACGAATAAAACCAGCATCAT

Reverse complement sequence

ATGATGCTGGTTTTATTCGTCCCTGCCGATGTGCCGAATGGGTTTCTAGCATAGTCCAGTTATTAAAAAGAATGGCAAGGTCAGGGTGTGCATTGATTTT[C/T,TC]
GAGATTTGAATAAAGCTACACCAAAGGACGAATATCCAATGCCAGTAGCCGATCAGCTGGTTGACGCCGCATCAGGGAACAAAATTTTGAGTTTTATGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.80% 43.20% 1.50% 4.89% GA: 5.69%
All Indica  2759 42.70% 56.50% 0.29% 0.00% GA: 0.54%
All Japonica  1512 42.90% 22.00% 3.90% 15.08% GA: 16.14%
Aus  269 63.60% 36.40% 0.00% 0.00% NA
Indica I  595 27.20% 72.40% 0.34% 0.00% NA
Indica II  465 60.90% 38.30% 0.43% 0.00% GA: 0.43%
Indica III  913 37.90% 60.20% 0.44% 0.00% GA: 1.42%
Indica Intermediate  786 49.10% 50.90% 0.00% 0.00% NA
Temperate Japonica  767 56.50% 5.90% 7.04% 23.86% GA: 6.78%
Tropical Japonica  504 21.60% 42.50% 0.40% 1.98% GA: 33.53%
Japonica Intermediate  241 44.00% 30.70% 1.24% 14.52% GA: 9.54%
VI/Aromatic  96 74.00% 24.00% 1.04% 1.04% NA
Intermediate  90 53.30% 30.00% 3.33% 2.22% GA: 11.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009414426 G -> GA LOC_Os10g18570.1 upstream_gene_variant ; 4551.0bp to feature; MODIFIER silent_mutation Average:26.279; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg1009414426 G -> GA LOC_Os10g18550.1 downstream_gene_variant ; 3187.0bp to feature; MODIFIER silent_mutation Average:26.279; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg1009414426 G -> GA LOC_Os10g18560.1 intron_variant ; MODIFIER silent_mutation Average:26.279; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg1009414426 G -> A LOC_Os10g18570.1 upstream_gene_variant ; 4552.0bp to feature; MODIFIER silent_mutation Average:26.279; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg1009414426 G -> A LOC_Os10g18550.1 downstream_gene_variant ; 3186.0bp to feature; MODIFIER silent_mutation Average:26.279; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg1009414426 G -> A LOC_Os10g18560.1 intron_variant ; MODIFIER silent_mutation Average:26.279; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N
vg1009414426 G -> DEL N N silent_mutation Average:26.279; most accessible tissue: Minghui63 young leaf, score: 44.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009414426 9.81E-06 NA mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 1.81E-08 4.99E-08 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 9.24E-06 NA mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 7.01E-06 NA mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 6.45E-07 1.36E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 1.38E-06 3.97E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 4.12E-06 9.28E-07 mr1145 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 4.42E-06 5.52E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 NA 3.64E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 NA 1.13E-08 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 NA 5.63E-10 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 5.17E-06 7.97E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 NA 1.54E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 9.04E-06 6.54E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 NA 1.68E-10 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 NA 3.47E-08 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 NA 1.72E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009414426 NA 3.96E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251