\
| Variant ID: vg1009413787 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9413787 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 81. )
AGCCTAAACGGTATTCCTTTCTGTGGAGGAATCAAAACAGGAGGAGAGCTGAGATACTCCTTGATATTATCCAAAGCCTTTTGCTGCTCTGCCCCCCCCC[A/G]
AGTAAATTGCTGATCGGCTTTTAATCTAAATAAGGGTGTAAAAGGTTCCAACCTTCTGGACAAATTAGAAATAAACCTTTTAACAAAATTTATCTTGCCG
CGGCAAGATAAATTTTGTTAAAAGGTTTATTTCTAATTTGTCCAGAAGGTTGGAACCTTTTACACCCTTATTTAGATTAAAAGCCGATCAGCAATTTACT[T/C]
GGGGGGGGGCAGAGCAGCAAAAGGCTTTGGATAATATCAAGGAGTATCTCAGCTCTCCTCCTGTTTTGATTCCTCCACAGAAAGGAATACCGTTTAGGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.40% | 39.00% | 9.54% | 3.05% | NA |
| All Indica | 2759 | 43.80% | 50.60% | 5.58% | 0.00% | NA |
| All Japonica | 1512 | 63.60% | 20.40% | 7.94% | 8.07% | NA |
| Aus | 269 | 6.30% | 34.90% | 53.16% | 5.58% | NA |
| Indica I | 595 | 29.90% | 60.30% | 9.75% | 0.00% | NA |
| Indica II | 465 | 61.90% | 35.10% | 3.01% | 0.00% | NA |
| Indica III | 913 | 40.50% | 56.80% | 2.63% | 0.00% | NA |
| Indica Intermediate | 786 | 47.50% | 45.20% | 7.38% | 0.00% | NA |
| Temperate Japonica | 767 | 73.10% | 5.10% | 11.34% | 10.43% | NA |
| Tropical Japonica | 504 | 56.50% | 40.10% | 2.58% | 0.79% | NA |
| Japonica Intermediate | 241 | 48.10% | 27.80% | 8.30% | 15.77% | NA |
| VI/Aromatic | 96 | 47.90% | 24.00% | 25.00% | 3.12% | NA |
| Intermediate | 90 | 58.90% | 25.60% | 11.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009413787 | A -> G | LOC_Os10g18560.1 | missense_variant ; p.Trp514Arg; MODERATE | nonsynonymous_codon ; W514R | Average:32.593; most accessible tissue: Minghui63 panicle, score: 50.413 | probably damaging |
2.864 |
DELETERIOUS | 0.00 |
| vg1009413787 | A -> DEL | LOC_Os10g18560.1 | N | frameshift_variant | Average:32.593; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009413787 | NA | 4.42E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | NA | 6.08E-07 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | NA | 3.88E-07 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | NA | 1.04E-08 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | 3.53E-08 | 4.44E-09 | mr1053_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | NA | 4.73E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | 3.22E-07 | 1.60E-07 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | NA | 5.78E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | NA | 3.71E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | NA | 2.84E-09 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | 2.58E-06 | 2.58E-06 | mr1516_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | NA | 4.96E-08 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | NA | 2.44E-09 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009413787 | 4.85E-06 | 4.85E-06 | mr1941_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |