\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009412063:

Variant ID: vg1009412063 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9412063
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, A: 0.24, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAATCGTTTTGCAACTCTGTTCGTCGAGAGCCGATTCTAACTTCCCATGGCAAAACAGCCTCATGTCCATAAATAAGTTTGTAAGGAGGAACTTGAAT[C/A]
GATCCATGACAAGCCATCCTATAAGACCATAATGCTTCAGGCAACTAAGTATGTCATTGCCGAGGATAATCAGAAACTTTCCGCTTAATCAACTTGATCA

Reverse complement sequence

TGATCAAGTTGATTAAGCGGAAAGTTTCTGATTATCCTCGGCAATGACATACTTAGTTGCCTGAAGCATTATGGTCTTATAGGATGGCTTGTCATGGATC[G/T]
ATTCAAGTTCCTCCTTACAAACTTATTTATGGACATGAGGCTGTTTTGCCATGGGAAGTTAGAATCGGCTCTCGACGAACAGAGTTGCAAAACGATTTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.20% 48.20% 1.21% 2.43% NA
All Indica  2759 58.00% 41.20% 0.83% 0.00% NA
All Japonica  1512 22.30% 68.70% 1.59% 7.41% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 72.60% 26.40% 1.01% 0.00% NA
Indica II  465 39.10% 60.00% 0.86% 0.00% NA
Indica III  913 61.00% 38.20% 0.77% 0.00% NA
Indica Intermediate  786 54.60% 44.70% 0.76% 0.00% NA
Temperate Japonica  767 5.90% 83.40% 1.83% 8.87% NA
Tropical Japonica  504 42.30% 56.90% 0.20% 0.60% NA
Japonica Intermediate  241 32.80% 46.50% 3.73% 17.01% NA
VI/Aromatic  96 43.80% 45.80% 9.38% 1.04% NA
Intermediate  90 41.10% 55.60% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009412063 C -> A LOC_Os10g18550.1 downstream_gene_variant ; 823.0bp to feature; MODIFIER silent_mutation Average:28.646; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg1009412063 C -> A LOC_Os10g18560.1 downstream_gene_variant ; 54.0bp to feature; MODIFIER silent_mutation Average:28.646; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg1009412063 C -> A LOC_Os10g18550-LOC_Os10g18560 intergenic_region ; MODIFIER silent_mutation Average:28.646; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg1009412063 C -> DEL N N silent_mutation Average:28.646; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009412063 9.83E-06 3.37E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 2.69E-06 NA mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 9.77E-07 1.48E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 2.61E-06 4.60E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 NA 9.67E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 NA 2.21E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 NA 1.44E-06 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 NA 1.52E-10 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 NA 1.08E-08 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 1.97E-07 8.61E-08 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 2.42E-06 NA mr1070_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 1.33E-07 NA mr1128_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 1.98E-07 8.57E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 1.02E-06 1.69E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 3.24E-06 5.59E-06 mr1204_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 7.34E-06 6.07E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 NA 3.03E-09 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 NA 3.00E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009412063 NA 7.68E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251