\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009411390:

Variant ID: vg1009411390 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9411390
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.85, T: 0.15, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTTTACTGTTTGTAAAAAAAATATACTGCATTTTATTATATATATGCCCCCCTAGTTTTACAATGTCGATAGCATTGATAAAATTATGAAACAACTA[A/T]
GGGCGATATAAAAATATCGGCCATTGTACATCGGCAAACCACAACCGATTACACCATGAAAAACACTAAGGGCGATATAACAATATCGGCCATTGTATAT

Reverse complement sequence

ATATACAATGGCCGATATTGTTATATCGCCCTTAGTGTTTTTCATGGTGTAATCGGTTGTGGTTTGCCGATGTACAATGGCCGATATTTTTATATCGCCC[T/A]
TAGTTGTTTCATAATTTTATCAATGCTATCGACATTGTAAAACTAGGGGGGCATATATATAATAAAATGCAGTATATTTTTTTTACAAACAGTAAAGTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.90% 25.60% 1.46% 0.04% NA
All Indica  2759 60.50% 38.90% 0.65% 0.00% NA
All Japonica  1512 91.60% 4.90% 3.37% 0.13% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 74.50% 24.90% 0.67% 0.00% NA
Indica II  465 41.50% 57.80% 0.65% 0.00% NA
Indica III  913 63.90% 35.70% 0.44% 0.00% NA
Indica Intermediate  786 57.10% 42.00% 0.89% 0.00% NA
Temperate Japonica  767 94.00% 0.30% 5.48% 0.26% NA
Tropical Japonica  504 86.30% 13.30% 0.40% 0.00% NA
Japonica Intermediate  241 95.00% 2.10% 2.90% 0.00% NA
VI/Aromatic  96 58.30% 41.70% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009411390 A -> T LOC_Os10g18550.1 downstream_gene_variant ; 150.0bp to feature; MODIFIER silent_mutation Average:34.047; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1009411390 A -> T LOC_Os10g18560.1 downstream_gene_variant ; 727.0bp to feature; MODIFIER silent_mutation Average:34.047; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1009411390 A -> T LOC_Os10g18550-LOC_Os10g18560 intergenic_region ; MODIFIER silent_mutation Average:34.047; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg1009411390 A -> DEL N N silent_mutation Average:34.047; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009411390 7.42E-08 1.42E-11 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 1.04E-08 2.40E-08 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 2.14E-06 NA mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 9.60E-07 9.25E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 7.27E-09 NA mr1128 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 3.49E-10 3.66E-09 mr1128 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 1.50E-06 4.01E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 NA 9.97E-11 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 NA 6.86E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 NA 5.56E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 NA 1.00E-08 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 NA 8.60E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 NA 4.05E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 NA 6.44E-09 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009411390 NA 7.87E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251