Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009403825:

Variant ID: vg1009403825 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9403825
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

GAAACAGAGCAGGAATCGGCTGGAGTCTAGATCGGCTACGATTGGGATCAGCTGGGTCTGAGTCGGGCTGAGTAAGCCGATACGGCCGATTCCGACAATA[C/T]
GACTTGTACGCGACATCGGGTTCAAGTTAACGTACTTCAGGATGATTGCCACGCATGGATAGAGTCAGAAGCTTCATAGAATGGTAGATATCTTATATAA

Reverse complement sequence

TTATATAAGATATCTACCATTCTATGAAGCTTCTGACTCTATCCATGCGTGGCAATCATCCTGAAGTACGTTAACTTGAACCCGATGTCGCGTACAAGTC[G/A]
TATTGTCGGAATCGGCCGTATCGGCTTACTCAGCCCGACTCAGACCCAGCTGATCCCAATCGTAGCCGATCTAGACTCCAGCCGATTCCTGCTCTGTTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.50%	25.90%	0.32%	3.26%	NA
All Indica	2759	66.90%	32.60%	0.51%	0.00%	NA
All Japonica	1512	89.20%	1.50%	0.07%	9.26%	NA
Aus	269	2.60%	97.40%	0.00%	0.00%	NA
Indica I	595	28.40%	70.80%	0.84%	0.00%	NA
Indica II	465	83.70%	15.70%	0.65%	0.00%	NA
Indica III	913	83.20%	16.50%	0.22%	0.00%	NA
Indica Intermediate	786	67.00%	32.40%	0.51%	0.00%	NA
Temperate Japonica	767	87.70%	1.00%	0.13%	11.08%	NA
Tropical Japonica	504	97.40%	1.60%	0.00%	0.99%	NA
Japonica Intermediate	241	76.80%	2.50%	0.00%	20.75%	NA
VI/Aromatic	96	65.60%	21.90%	0.00%	12.50%	NA
Intermediate	90	75.60%	22.20%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009403825	C -> T	LOC_Os10g18530.1	upstream_gene_variant ; 3382.0bp to feature; MODIFIER	silent_mutation	Average:42.718; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1009403825	C -> T	LOC_Os10g18550.1	upstream_gene_variant ; 4219.0bp to feature; MODIFIER	silent_mutation	Average:42.718; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1009403825	C -> T	LOC_Os10g18540.1	intron_variant ; MODIFIER	silent_mutation	Average:42.718; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg1009403825	C -> DEL	N	N	silent_mutation	Average:42.718; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009403825	NA	3.85E-14	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	3.11E-06	NA	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	9.87E-06	NA	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	3.13E-21	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	2.56E-13	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	3.97E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	6.04E-06	NA	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	1.95E-06	NA	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	1.03E-06	NA	mr1147	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	5.20E-06	NA	mr1147	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	7.15E-13	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	1.16E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	8.06E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	8.47E-34	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	2.29E-15	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	8.78E-15	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	3.95E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	4.53E-22	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	4.46E-17	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	4.44E-06	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	7.18E-18	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	6.44E-32	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	1.91E-18	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	1.92E-13	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	1.83E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	1.39E-14	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	6.13E-19	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825	NA	1.14E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251