\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009403825:

Variant ID: vg1009403825 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9403825
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GAAACAGAGCAGGAATCGGCTGGAGTCTAGATCGGCTACGATTGGGATCAGCTGGGTCTGAGTCGGGCTGAGTAAGCCGATACGGCCGATTCCGACAATA[C/T]
GACTTGTACGCGACATCGGGTTCAAGTTAACGTACTTCAGGATGATTGCCACGCATGGATAGAGTCAGAAGCTTCATAGAATGGTAGATATCTTATATAA

Reverse complement sequence

TTATATAAGATATCTACCATTCTATGAAGCTTCTGACTCTATCCATGCGTGGCAATCATCCTGAAGTACGTTAACTTGAACCCGATGTCGCGTACAAGTC[G/A]
TATTGTCGGAATCGGCCGTATCGGCTTACTCAGCCCGACTCAGACCCAGCTGATCCCAATCGTAGCCGATCTAGACTCCAGCCGATTCCTGCTCTGTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 25.90% 0.32% 3.26% NA
All Indica  2759 66.90% 32.60% 0.51% 0.00% NA
All Japonica  1512 89.20% 1.50% 0.07% 9.26% NA
Aus  269 2.60% 97.40% 0.00% 0.00% NA
Indica I  595 28.40% 70.80% 0.84% 0.00% NA
Indica II  465 83.70% 15.70% 0.65% 0.00% NA
Indica III  913 83.20% 16.50% 0.22% 0.00% NA
Indica Intermediate  786 67.00% 32.40% 0.51% 0.00% NA
Temperate Japonica  767 87.70% 1.00% 0.13% 11.08% NA
Tropical Japonica  504 97.40% 1.60% 0.00% 0.99% NA
Japonica Intermediate  241 76.80% 2.50% 0.00% 20.75% NA
VI/Aromatic  96 65.60% 21.90% 0.00% 12.50% NA
Intermediate  90 75.60% 22.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009403825 C -> T LOC_Os10g18530.1 upstream_gene_variant ; 3382.0bp to feature; MODIFIER silent_mutation Average:42.718; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg1009403825 C -> T LOC_Os10g18550.1 upstream_gene_variant ; 4219.0bp to feature; MODIFIER silent_mutation Average:42.718; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg1009403825 C -> T LOC_Os10g18540.1 intron_variant ; MODIFIER silent_mutation Average:42.718; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg1009403825 C -> DEL N N silent_mutation Average:42.718; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009403825 NA 3.85E-14 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 3.11E-06 NA mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 9.87E-06 NA mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 3.13E-21 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 2.56E-13 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 3.97E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 6.04E-06 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 1.95E-06 NA mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 1.03E-06 NA mr1147 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 5.20E-06 NA mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 7.15E-13 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 1.16E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 8.06E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 8.47E-34 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 2.29E-15 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 8.78E-15 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 3.95E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 4.53E-22 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 4.46E-17 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 4.44E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 7.18E-18 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 6.44E-32 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 1.91E-18 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 1.92E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 1.83E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 1.39E-14 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 6.13E-19 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009403825 NA 1.14E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251