Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009401525:

Variant ID: vg1009401525 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9401525
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, C: 0.08, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


GCCCAAAAACCATAGTAGCCCTAGTCTATCTATTATATACTTAAAAGTTTATTAAACTTCCTACAAACGCTCTCAAGTAGCTACGTGGGACTCCTATAAA[A/C]
GTTCCTATGCCGCCACGTGGCATTATCTAATCTCACCGTCGATTTTCATTTAATTGGTGGACCCGCTATTTTATACCATTAGATTAGATCTATATGTATC

Reverse complement sequence

GATACATATAGATCTAATCTAATGGTATAAAATAGCGGGTCCACCAATTAAATGAAAATCGACGGTGAGATTAGATAATGCCACGTGGCGGCATAGGAAC[T/G]
TTTATAGGAGTCCCACGTAGCTACTTGAGAGCGTTTGTAGGAAGTTTAATAAACTTTTAAGTATATAATAGATAGACTAGGGCTACTATGGTTTTTGGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 41.70% 3.24% 6.64% NA
All Indica  2759 58.10% 40.90% 0.83% 0.22% NA
All Japonica  1512 22.60% 52.40% 7.28% 17.79% NA
Aus  269 97.40% 2.20% 0.00% 0.37% NA
Indica I  595 72.80% 26.70% 0.50% 0.00% NA
Indica II  465 39.10% 60.40% 0.43% 0.00% NA
Indica III  913 61.00% 36.90% 1.64% 0.44% NA
Indica Intermediate  786 54.70% 44.70% 0.38% 0.25% NA
Temperate Japonica  767 6.10% 77.30% 3.78% 12.78% NA
Tropical Japonica  504 42.90% 21.20% 8.73% 27.18% NA
Japonica Intermediate  241 32.40% 38.20% 15.35% 14.11% NA
VI/Aromatic  96 43.80% 11.50% 14.58% 30.21% NA
Intermediate  90 43.30% 40.00% 6.67% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009401525 A -> C LOC_Os10g18530.1 upstream_gene_variant ; 1082.0bp to feature; MODIFIER silent_mutation Average:64.172; most accessible tissue: Zhenshan97 flag leaf, score: 86.987 N N N N
vg1009401525 A -> C LOC_Os10g18540.1 upstream_gene_variant ; 1688.0bp to feature; MODIFIER silent_mutation Average:64.172; most accessible tissue: Zhenshan97 flag leaf, score: 86.987 N N N N
vg1009401525 A -> C LOC_Os10g18530-LOC_Os10g18540 intergenic_region ; MODIFIER silent_mutation Average:64.172; most accessible tissue: Zhenshan97 flag leaf, score: 86.987 N N N N
vg1009401525 A -> DEL N N silent_mutation Average:64.172; most accessible tissue: Zhenshan97 flag leaf, score: 86.987 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1009401525 A C 0.09 0.02 0.03 0.02 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009401525 4.64E-06 2.18E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009401525 7.43E-06 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009401525 1.90E-06 2.69E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009401525 5.43E-06 8.24E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009401525 NA 2.36E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009401525 NA 1.02E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009401525 8.09E-07 NA mr1027_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009401525 NA 7.56E-10 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009401525 3.54E-06 NA mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009401525 8.22E-06 7.07E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009401525 2.61E-06 NA mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009401525 7.65E-06 NA mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009401525 NA 2.76E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251