\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009396029:

Variant ID: vg1009396029 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9396029
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, T: 0.20, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCGAAAATTCCGAAGTAACTTTTAATATTTTTTTTAATAATCAGGCTAAAAGTAAAAATTACATCAATTATTACATTACTATAGGAATAATTTTCCTG[G/T]
ACCGGAGTCATTTATATTGCAAACGGACCGTAAGTGGTCGGGTATGTGAAGATCGTGCTCCATTTTCGTGTGCGACTCATGAAGATGACCGCATGGAAAA

Reverse complement sequence

TTTTCCATGCGGTCATCTTCATGAGTCGCACACGAAAATGGAGCACGATCTTCACATACCCGACCACTTACGGTCCGTTTGCAATATAAATGACTCCGGT[C/A]
CAGGAAAATTATTCCTATAGTAATGTAATAATTGATGTAATTTTTACTTTTAGCCTGATTATTAAAAAAAATATTAAAAGTTACTTCGGAATTTTCGCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.60% 30.90% 0.47% 0.00% NA
All Indica  2759 58.90% 40.50% 0.65% 0.00% NA
All Japonica  1512 94.50% 5.30% 0.20% 0.00% NA
Aus  269 36.80% 63.20% 0.00% 0.00% NA
Indica I  595 74.80% 24.70% 0.50% 0.00% NA
Indica II  465 40.00% 59.40% 0.65% 0.00% NA
Indica III  913 62.90% 36.50% 0.66% 0.00% NA
Indica Intermediate  786 53.30% 45.90% 0.76% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 86.30% 13.30% 0.40% 0.00% NA
Japonica Intermediate  241 95.40% 4.10% 0.41% 0.00% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009396029 G -> T LOC_Os10g18510.1 upstream_gene_variant ; 529.0bp to feature; MODIFIER silent_mutation Average:45.067; most accessible tissue: Callus, score: 58.913 N N N N
vg1009396029 G -> T LOC_Os10g18520.1 downstream_gene_variant ; 252.0bp to feature; MODIFIER silent_mutation Average:45.067; most accessible tissue: Callus, score: 58.913 N N N N
vg1009396029 G -> T LOC_Os10g18530.1 downstream_gene_variant ; 3713.0bp to feature; MODIFIER silent_mutation Average:45.067; most accessible tissue: Callus, score: 58.913 N N N N
vg1009396029 G -> T LOC_Os10g18510-LOC_Os10g18520 intergenic_region ; MODIFIER silent_mutation Average:45.067; most accessible tissue: Callus, score: 58.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009396029 1.22E-08 2.75E-08 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 3.03E-06 NA mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 2.36E-07 3.95E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 NA 2.49E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 1.68E-06 3.19E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 3.34E-06 1.95E-06 mr1437 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 NA 3.18E-11 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 NA 2.53E-10 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 NA 1.95E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 NA 7.77E-08 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 4.05E-07 8.49E-08 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 1.99E-06 2.02E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 NA 1.04E-07 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 NA 9.28E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 NA 2.49E-12 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029 NA 2.52E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251