Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009396029:

Variant ID: vg1009396029 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9396029
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, T: 0.20, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCGAAAATTCCGAAGTAACTTTTAATATTTTTTTTAATAATCAGGCTAAAAGTAAAAATTACATCAATTATTACATTACTATAGGAATAATTTTCCTG[G/T]
ACCGGAGTCATTTATATTGCAAACGGACCGTAAGTGGTCGGGTATGTGAAGATCGTGCTCCATTTTCGTGTGCGACTCATGAAGATGACCGCATGGAAAA

Reverse complement sequence

TTTTCCATGCGGTCATCTTCATGAGTCGCACACGAAAATGGAGCACGATCTTCACATACCCGACCACTTACGGTCCGTTTGCAATATAAATGACTCCGGT[C/A]
CAGGAAAATTATTCCTATAGTAATGTAATAATTGATGTAATTTTTACTTTTAGCCTGATTATTAAAAAAAATATTAAAAGTTACTTCGGAATTTTCGCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.60%	30.90%	0.47%	0.00%	NA
All Indica	2759	58.90%	40.50%	0.65%	0.00%	NA
All Japonica	1512	94.50%	5.30%	0.20%	0.00%	NA
Aus	269	36.80%	63.20%	0.00%	0.00%	NA
Indica I	595	74.80%	24.70%	0.50%	0.00%	NA
Indica II	465	40.00%	59.40%	0.65%	0.00%	NA
Indica III	913	62.90%	36.50%	0.66%	0.00%	NA
Indica Intermediate	786	53.30%	45.90%	0.76%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	86.30%	13.30%	0.40%	0.00%	NA
Japonica Intermediate	241	95.40%	4.10%	0.41%	0.00%	NA
VI/Aromatic	96	37.50%	62.50%	0.00%	0.00%	NA
Intermediate	90	62.20%	36.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009396029	G -> T	LOC_Os10g18510.1	upstream_gene_variant ; 529.0bp to feature; MODIFIER	silent_mutation	Average:45.067; most accessible tissue: Callus, score: 58.913	N	N	N	N
vg1009396029	G -> T	LOC_Os10g18520.1	downstream_gene_variant ; 252.0bp to feature; MODIFIER	silent_mutation	Average:45.067; most accessible tissue: Callus, score: 58.913	N	N	N	N
vg1009396029	G -> T	LOC_Os10g18530.1	downstream_gene_variant ; 3713.0bp to feature; MODIFIER	silent_mutation	Average:45.067; most accessible tissue: Callus, score: 58.913	N	N	N	N
vg1009396029	G -> T	LOC_Os10g18510-LOC_Os10g18520	intergenic_region ; MODIFIER	silent_mutation	Average:45.067; most accessible tissue: Callus, score: 58.913	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009396029	1.22E-08	2.75E-08	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	3.03E-06	NA	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	2.36E-07	3.95E-07	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	NA	2.49E-06	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	1.68E-06	3.19E-06	mr1147	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	3.34E-06	1.95E-06	mr1437	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	NA	3.18E-11	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	NA	2.53E-10	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	NA	1.95E-09	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	NA	7.77E-08	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	4.05E-07	8.49E-08	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	1.99E-06	2.02E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	NA	1.04E-07	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	NA	9.28E-06	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	NA	2.49E-12	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009396029	NA	2.52E-10	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251