\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009371286:

Variant ID: vg1009371286 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9371286
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, A: 0.39, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGCACGGCGATGATGAGCGGCGAGTGCTGGCGCCGGTGGCGGACGTGTCATGCGCAGGTTGGTCTGTTGGGTCAGTCTGCTACCCAATTTTCGAAGCC[G/A]
AACCCGAGTCTGCTGCTACATCCACATTCCCTGACGTACCCAGATCATCATTAGTTGTATCTGTCGTATTTCCTCCATCTATATCTGCATTCTCATCAGT

Reverse complement sequence

ACTGATGAGAATGCAGATATAGATGGAGGAAATACGACAGATACAACTAATGATGATCTGGGTACGTCAGGGAATGTGGATGTAGCAGCAGACTCGGGTT[C/T]
GGCTTCGAAAATTGGGTAGCAGACTGACCCAACAGACCAACCTGCGCATGACACGTCCGCCACCGGCGCCAGCACTCGCCGCTCATCATCGCCGTGCCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 25.30% 0.89% 23.19% NA
All Indica  2759 40.80% 27.00% 0.94% 31.28% NA
All Japonica  1512 72.70% 13.20% 0.66% 13.43% NA
Aus  269 36.40% 61.30% 0.00% 2.23% NA
Indica I  595 75.00% 1.70% 0.34% 23.03% NA
Indica II  465 20.60% 25.20% 2.37% 51.83% NA
Indica III  913 29.40% 46.40% 0.88% 23.33% NA
Indica Intermediate  786 40.10% 24.70% 0.64% 34.61% NA
Temperate Japonica  767 82.70% 5.00% 0.78% 11.60% NA
Tropical Japonica  504 67.50% 19.80% 0.20% 12.50% NA
Japonica Intermediate  241 51.90% 25.70% 1.24% 21.16% NA
VI/Aromatic  96 25.00% 61.50% 6.25% 7.29% NA
Intermediate  90 51.10% 30.00% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009371286 G -> A LOC_Os10g18420.1 upstream_gene_variant ; 4381.0bp to feature; MODIFIER silent_mutation Average:43.137; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg1009371286 G -> A LOC_Os10g18430.1 downstream_gene_variant ; 3101.0bp to feature; MODIFIER silent_mutation Average:43.137; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg1009371286 G -> A LOC_Os10g18440.1 intron_variant ; MODIFIER silent_mutation Average:43.137; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg1009371286 G -> DEL N N silent_mutation Average:43.137; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009371286 NA 2.24E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1009371286 NA 1.73E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 6.82E-09 8.62E-14 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 1.65E-09 4.75E-14 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 1.23E-08 3.43E-13 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 NA 1.46E-07 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 1.04E-07 6.59E-19 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 4.13E-08 6.18E-12 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 6.88E-08 4.19E-10 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 NA 1.40E-11 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 NA 7.02E-09 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 1.80E-09 5.54E-13 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 4.08E-07 9.35E-22 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 NA 2.95E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 NA 7.11E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 NA 6.40E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 2.20E-08 4.62E-10 mr1917 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 2.35E-07 5.95E-14 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 6.47E-09 1.09E-15 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 2.94E-07 2.95E-12 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 NA 5.30E-18 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 3.06E-06 2.71E-11 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 6.68E-09 9.77E-16 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 1.59E-06 3.22E-12 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 2.00E-07 1.68E-13 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 2.09E-06 2.34E-08 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 2.90E-07 4.26E-22 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 NA 1.24E-06 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 NA 2.65E-13 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009371286 NA 4.80E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251