Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009362935:

Variant ID: vg1009362935 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9362935
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAGCTGGCCTTTATTAAGTGCAAATGAATTTGGATCAAAACTCAACAAACTCCACCTTGAGACAAATTCCTTCTTGTAGTATGAATCAATCCTTCACCC[T/A]
AAACACAACAAAGACAAAAAAACACTTTCGGCGCCAAATAGCCTCTCAGGCTAAACCACTATACCAACTAAGCTTGAGCAAAGCTCAAACTTAGCAACAG

Reverse complement sequence

CTGTTGCTAAGTTTGAGCTTTGCTCAAGCTTAGTTGGTATAGTGGTTTAGCCTGAGAGGCTATTTGGCGCCGAAAGTGTTTTTTTGTCTTTGTTGTGTTT[A/T]
GGGTGAAGGATTGATTCATACTACAAGAAGGAATTTGTCTCAAGGTGGAGTTTGTTGAGTTTTGATCCAAATTCATTTGCACTTAATAAAGGCCAGCTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.90%	0.40%	1.44%	25.29%	NA
All Indica	2759	62.80%	0.70%	2.03%	34.47%	NA
All Japonica	1512	85.50%	0.00%	0.66%	13.82%	NA
Aus	269	97.80%	0.00%	0.00%	2.23%	NA
Indica I	595	75.80%	0.20%	0.50%	23.53%	NA
Indica II	465	44.30%	1.90%	3.66%	50.11%	NA
Indica III	913	66.60%	0.50%	1.97%	30.89%	NA
Indica Intermediate	786	59.40%	0.60%	2.29%	37.66%	NA
Temperate Japonica	767	87.90%	0.00%	0.26%	11.86%	NA
Tropical Japonica	504	85.70%	0.00%	0.60%	13.69%	NA
Japonica Intermediate	241	77.60%	0.00%	2.07%	20.33%	NA
VI/Aromatic	96	85.40%	0.00%	0.00%	14.58%	NA
Intermediate	90	81.10%	0.00%	2.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009362935	T -> A	LOC_Os10g18430.1	upstream_gene_variant ; 4279.0bp to feature; MODIFIER	silent_mutation	Average:28.509; most accessible tissue: Callus, score: 46.827	N	N	N	N
vg1009362935	T -> A	LOC_Os10g18410.1	downstream_gene_variant ; 463.0bp to feature; MODIFIER	silent_mutation	Average:28.509; most accessible tissue: Callus, score: 46.827	N	N	N	N
vg1009362935	T -> A	LOC_Os10g18420.1	downstream_gene_variant ; 168.0bp to feature; MODIFIER	silent_mutation	Average:28.509; most accessible tissue: Callus, score: 46.827	N	N	N	N
vg1009362935	T -> A	LOC_Os10g18410-LOC_Os10g18420	intergenic_region ; MODIFIER	silent_mutation	Average:28.509; most accessible tissue: Callus, score: 46.827	N	N	N	N
vg1009362935	T -> DEL	N	N	silent_mutation	Average:28.509; most accessible tissue: Callus, score: 46.827	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009362935	8.25E-11	6.71E-43	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362935	7.40E-06	1.53E-26	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362935	5.65E-12	NA	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362935	4.89E-10	2.52E-15	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362935	3.44E-13	3.60E-40	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362935	7.09E-09	4.25E-23	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362935	1.03E-09	3.06E-15	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362935	7.74E-09	1.18E-09	mr1514_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362935	2.63E-15	1.19E-34	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009362935	1.40E-11	8.89E-23	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251