\
| Variant ID: vg1009344337 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9344337 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 218. )
CTGCATCGAACGGCTGCATGGTTCGGCCGAACCATGGGCTAGGCCAAACCAGCTCAATCTCGGCTGGCGGCCTTCTTATCTCTTCCCTTATTCAGAACAA[C/T]
AAATTTTGGGCCTATTGGATTGTGGCAATTCTGTGTTCTTGGCCCATTCATCCATAAGTCTGATTCTCGATAGCGTTCGTTTGATTGATCGTCCGTTTTG
CAAAACGGACGATCAATCAAACGAACGCTATCGAGAATCAGACTTATGGATGAATGGGCCAAGAACACAGAATTGCCACAATCCAATAGGCCCAAAATTT[G/A]
TTGTTCTGAATAAGGGAAGAGATAAGAAGGCCGCCAGCCGAGATTGAGCTGGTTTGGCCTAGCCCATGGTTCGGCCGAACCATGCAGCCGTTCGATGCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 45.30% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 30.80% | 69.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 4.40% | 95.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 25.80% | 74.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 50.70% | 49.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 30.70% | 69.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 84.60% | 15.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 85.30% | 14.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009344337 | C -> T | LOC_Os10g18380.1 | upstream_gene_variant ; 1026.0bp to feature; MODIFIER | silent_mutation | Average:45.25; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1009344337 | C -> T | LOC_Os10g18390.1 | upstream_gene_variant ; 1138.0bp to feature; MODIFIER | silent_mutation | Average:45.25; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1009344337 | C -> T | LOC_Os10g18400.1 | upstream_gene_variant ; 4714.0bp to feature; MODIFIER | silent_mutation | Average:45.25; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg1009344337 | C -> T | LOC_Os10g18380-LOC_Os10g18390 | intergenic_region ; MODIFIER | silent_mutation | Average:45.25; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009344337 | NA | 5.34E-42 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 5.68E-08 | 2.79E-18 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 7.76E-06 | 3.08E-08 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 1.02E-06 | 2.99E-08 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 7.39E-07 | 5.08E-09 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 1.62E-12 | 3.54E-23 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 6.34E-07 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 3.71E-06 | 1.55E-07 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 1.77E-06 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 1.48E-39 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 4.20E-07 | 1.49E-16 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 3.81E-06 | 2.25E-08 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 9.75E-18 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 1.72E-09 | mr1261 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 8.88E-14 | 3.17E-25 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 1.31E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 1.58E-07 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 2.51E-06 | mr1807 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 3.87E-17 | mr1913 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 1.08E-10 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 1.99E-06 | 1.59E-09 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 9.07E-07 | 4.72E-10 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 6.18E-08 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 4.94E-12 | 1.19E-25 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 1.04E-07 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 1.26E-06 | 9.03E-12 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 8.43E-06 | 1.92E-40 | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 2.54E-08 | 7.01E-18 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 6.11E-11 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 4.20E-06 | 2.20E-10 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 4.00E-06 | NA | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 4.47E-07 | 4.11E-08 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | 1.15E-12 | 8.73E-26 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 1.22E-07 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 1.32E-06 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 1.07E-09 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 7.73E-06 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 4.57E-07 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 7.22E-07 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009344337 | NA | 4.76E-06 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |