\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009329663:

Variant ID: vg1009329663 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9329663
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTAGTTTGACTTATTGCCACATTTAAGATGTTGCAAGTAAGGCTTTGCCACTCAATCTATGACATATGGGCCCTTATGCATTTATGGTAGGGGCAATTT[C/T]
GTTTTTATCCTACTTTGATGTCTAATATTGATTTTACCCCTATTTTTTAGAGTTTTCATTTTTACCCTCACTTTTTTTAACTGAATGCTTGTTTTTCCCC

Reverse complement sequence

GGGGAAAAACAAGCATTCAGTTAAAAAAAGTGAGGGTAAAAATGAAAACTCTAAAAAATAGGGGTAAAATCAATATTAGACATCAAAGTAGGATAAAAAC[G/A]
AAATTGCCCCTACCATAAATGCATAAGGGCCCATATGTCATAGATTGAGTGGCAAAGCCTTACTTGCAACATCTTAAATGTGGCAATAAGTCAAACTACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.00% 12.40% 23.44% 31.19% NA
All Indica  2759 30.00% 2.90% 30.77% 36.32% NA
All Japonica  1512 36.80% 24.70% 9.66% 28.90% NA
Aus  269 46.10% 34.90% 14.87% 4.09% NA
Indica I  595 41.00% 1.80% 29.92% 27.23% NA
Indica II  465 18.30% 0.40% 35.91% 45.38% NA
Indica III  913 30.40% 3.40% 27.38% 38.77% NA
Indica Intermediate  786 28.10% 4.60% 32.32% 34.99% NA
Temperate Japonica  767 53.70% 6.30% 10.43% 29.60% NA
Tropical Japonica  504 11.90% 57.10% 10.52% 20.44% NA
Japonica Intermediate  241 34.90% 15.40% 5.39% 44.40% NA
VI/Aromatic  96 21.90% 24.00% 52.08% 2.08% NA
Intermediate  90 32.20% 17.80% 25.56% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009329663 C -> T LOC_Os10g18360.1 upstream_gene_variant ; 1727.0bp to feature; MODIFIER silent_mutation Average:34.254; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg1009329663 C -> T LOC_Os10g18364.1 upstream_gene_variant ; 982.0bp to feature; MODIFIER silent_mutation Average:34.254; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg1009329663 C -> T LOC_Os10g18360-LOC_Os10g18364 intergenic_region ; MODIFIER silent_mutation Average:34.254; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg1009329663 C -> DEL N N silent_mutation Average:34.254; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009329663 NA 3.58E-09 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 1.10E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 7.28E-08 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 1.21E-06 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 1.59E-06 mr1359 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 7.14E-08 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 2.38E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 1.64E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 2.07E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 1.72E-07 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 1.29E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 3.89E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 1.28E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 7.94E-10 mr1398_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 8.62E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 5.31E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 1.80E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009329663 NA 4.51E-09 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251