\
| Variant ID: vg1009327905 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9327905 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 232. )
GGCCGCGTTCGGCACTTGCACAGAGGCGGCAGGGGCCGAAGGCGTTTGAGATGGCGCAGATGTGGAAGCAGATGGTCCTCCTCCATCTTCGGCCACTGGC[G/A]
CCGAATGCTCTGCTCCCTCCTCGGCGGCCATGTCCGGTGCGGCGTTGCTTTCCTTCCGCCTTGCAACCTTCTCCTTCACGACCTTCTTCGGTGGCATTCA
TGAATGCCACCGAAGAAGGTCGTGAAGGAGAAGGTTGCAAGGCGGAAGGAAAGCAACGCCGCACCGGACATGGCCGCCGAGGAGGGAGCAGAGCATTCGG[C/T]
GCCAGTGGCCGAAGATGGAGGAGGACCATCTGCTTCCACATCTGCGCCATCTCAAACGCCTTCGGCCCCTGCCGCCTCTGTGCAAGTGCCGAACGCGGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.50% | 5.90% | 7.17% | 10.41% | NA |
| All Indica | 2759 | 62.40% | 8.30% | 11.78% | 17.54% | NA |
| All Japonica | 1512 | 96.50% | 3.00% | 0.40% | 0.07% | NA |
| Aus | 269 | 98.50% | 0.40% | 0.37% | 0.74% | NA |
| Indica I | 595 | 74.60% | 5.00% | 9.75% | 10.59% | NA |
| Indica II | 465 | 43.70% | 15.70% | 14.19% | 26.45% | NA |
| Indica III | 913 | 67.40% | 5.90% | 9.42% | 17.31% | NA |
| Indica Intermediate | 786 | 58.50% | 9.00% | 14.63% | 17.81% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.70% | 8.30% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 5.60% | 6.67% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009327905 | G -> A | LOC_Os10g18360.1 | missense_variant ; p.Ala11Val; MODERATE | nonsynonymous_codon ; A11V | Average:55.749; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 | unknown | unknown | TOLERATED | 0.06 |
| vg1009327905 | G -> DEL | LOC_Os10g18360.1 | N | frameshift_variant | Average:55.749; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009327905 | NA | 1.46E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 3.00E-07 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 8.61E-08 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 1.50E-06 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 3.28E-06 | mr1057_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | 7.82E-06 | 2.65E-08 | mr1126_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | 3.06E-06 | 3.06E-06 | mr1126_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | 4.30E-06 | NA | mr1128_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | 4.92E-07 | 2.06E-08 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 3.77E-06 | mr1204_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 1.07E-06 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 6.06E-06 | mr1252_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 6.11E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | 9.50E-06 | 9.50E-06 | mr1569_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | 4.68E-06 | 4.68E-06 | mr1730_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 1.84E-06 | mr1757_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 4.30E-06 | mr1849_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 8.23E-07 | mr1866_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 9.10E-06 | mr1955_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327905 | NA | 4.35E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |