\
| Variant ID: vg1009327768 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9327768 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 99. )
GCCTGCATAGCGGCGAGCGCAGTCGGGGCTGCCGCCGGCTGCGATGGAGTGGCTTGGGGCACCACTAGTTGGCTTGTCGAAAGGATCTCCGCCCTGGTCT[G/A]
GAGTGCCCTTGCCACAGCAGCCGCCTTCGCCACGTCGGCCGCGTTCGGCACTTGCACAGAGGCGGCAGGGGCCGAAGGCGTTTGAGATGGCGCAGATGTG
CACATCTGCGCCATCTCAAACGCCTTCGGCCCCTGCCGCCTCTGTGCAAGTGCCGAACGCGGCCGACGTGGCGAAGGCGGCTGCTGTGGCAAGGGCACTC[C/T]
AGACCAGGGCGGAGATCCTTTCGACAAGCCAACTAGTGGTGCCCCAAGCCACTCCATCGCAGCCGGCGGCAGCCCCGACTGCGCTCGCCGCTATGCAGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.00% | 24.70% | 0.34% | 0.04% | NA |
| All Indica | 2759 | 60.00% | 39.30% | 0.58% | 0.07% | NA |
| All Japonica | 1512 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 73.80% | 25.70% | 0.34% | 0.17% | NA |
| Indica II | 465 | 39.80% | 58.90% | 1.29% | 0.00% | NA |
| Indica III | 913 | 64.30% | 35.20% | 0.44% | 0.11% | NA |
| Indica Intermediate | 786 | 56.60% | 42.90% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009327768 | G -> A | LOC_Os10g18360.1 | stop_gained ; p.Gln57*; HIGH | stop_gained | Average:66.783; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 | N | N | N | N |
| vg1009327768 | G -> DEL | LOC_Os10g18360.1 | N | frameshift_variant | Average:66.783; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009327768 | 2.53E-06 | 1.09E-10 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | 7.17E-07 | 3.26E-07 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | 2.95E-06 | NA | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | 1.31E-06 | 9.66E-07 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | 6.14E-06 | 7.07E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | NA | 9.77E-11 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | NA | 3.15E-09 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | NA | 3.18E-09 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | 6.10E-07 | 8.34E-10 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | 5.08E-07 | 1.10E-07 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | 5.28E-07 | NA | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | 1.37E-07 | 3.20E-07 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | 2.01E-06 | 7.81E-13 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | 3.65E-06 | 3.08E-06 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | 1.22E-06 | 2.38E-08 | mr1250_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | 1.74E-06 | 1.74E-06 | mr1250_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | NA | 1.55E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | NA | 6.96E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | NA | 3.31E-09 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009327768 | NA | 3.79E-09 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |