\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009321613:

Variant ID: vg1009321613 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 9321613
Reference Allele: GAAlternative Allele: AA,G
Primary Allele: GASecondary Allele: AA

Inferred Ancestral Allele : GA (evidence from allele frequency in Oryza rufipogon: GA: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCAGCGGTTTTCACAGGAGATGGCGAAGACCACCGAATCCGCGAGAACTGCTTGTCAAACGCTCCGCCTCGCCCTTACCGACATGGGCGCGAAAGTGC[GA/AA,G]
GGGGTTCCTGCCGAGGATGCATCAGCCTTCGACTTCTCCGAGTGGACCCAGCAGGCTGGCGGATCGGTTTCGGACTGCGCCATCGCGTACGGCGATTGCT

Reverse complement sequence

AGCAATCGCCGTACGCGATGGCGCAGTCCGAAACCGATCCGCCAGCCTGCTGGGTCCACTCGGAGAAGTCGAAGGCTGATGCATCCTCGGCAGGAACCCC[TC/TT,C]
GCACTTTCGCGCCCATGTCGGTAAGGGCGAGGCGGAGCGTTTGACAAGCAGTTCTCGCGGATTCGGTGGTCTTCGCCATCTCCTGTGAAAACCGCTGCGA

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.80% 24.50% 1.44% 5.21% G: 0.11%
All Indica  2759 58.60% 39.00% 0.47% 1.92% NA
All Japonica  1512 96.00% 3.50% 0.13% 0.40% NA
Aus  269 15.20% 2.20% 17.10% 63.57% G: 1.86%
Indica I  595 73.40% 25.00% 0.17% 1.34% NA
Indica II  465 39.40% 58.70% 0.00% 1.94% NA
Indica III  913 63.30% 34.90% 0.44% 1.31% NA
Indica Intermediate  786 53.30% 42.60% 1.02% 3.05% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 89.70% 9.30% 0.00% 0.99% NA
Japonica Intermediate  241 97.10% 1.70% 0.83% 0.41% NA
VI/Aromatic  96 79.20% 3.10% 5.21% 12.50% NA
Intermediate  90 73.30% 20.00% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009321613 GA -> DEL LOC_Os10g18350.1 N frameshift_variant Average:53.398; most accessible tissue: Minghui63 young leaf, score: 72.959 N N N N
vg1009321613 GA -> G LOC_Os10g18350.1 frameshift_variant ; p.Val740fs; HIGH frameshift_variant Average:53.398; most accessible tissue: Minghui63 young leaf, score: 72.959 N N N N
vg1009321613 GA -> AA LOC_Os10g18350.1 missense_variant ; p.Arg738Gln; MODERATE nonsynonymous_codon ; R738Q Average:53.398; most accessible tissue: Minghui63 young leaf, score: 72.959 benign +1.071 N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009321613 5.45E-07 4.38E-11 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 4.99E-07 2.18E-07 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 9.10E-07 NA mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 1.25E-06 NA mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 2.55E-07 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 6.23E-08 9.22E-08 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 NA 9.97E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 2.43E-06 2.22E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 NA 3.70E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 NA 1.98E-10 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 NA 4.46E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 NA 3.01E-08 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 2.60E-07 5.22E-10 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 7.57E-07 1.66E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 9.59E-07 NA mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 5.62E-06 NA mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 6.23E-08 3.24E-14 mr1147_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 8.79E-07 1.08E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 1.80E-06 NA mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 5.53E-06 9.36E-08 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 NA 9.31E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 NA 7.66E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 NA 6.79E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 NA 1.66E-09 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613 NA 3.00E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251