Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009321613:

Variant ID: vg1009321613 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 9321613
Reference Allele: GA	Alternative Allele: AA,G
Primary Allele: GA	Secondary Allele: AA

Inferred Ancestral Allele : GA (evidence from allele frequency in Oryza rufipogon: GA: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

TCGCAGCGGTTTTCACAGGAGATGGCGAAGACCACCGAATCCGCGAGAACTGCTTGTCAAACGCTCCGCCTCGCCCTTACCGACATGGGCGCGAAAGTGC[GA/AA,G]
GGGGTTCCTGCCGAGGATGCATCAGCCTTCGACTTCTCCGAGTGGACCCAGCAGGCTGGCGGATCGGTTTCGGACTGCGCCATCGCGTACGGCGATTGCT

Reverse complement sequence

AGCAATCGCCGTACGCGATGGCGCAGTCCGAAACCGATCCGCCAGCCTGCTGGGTCCACTCGGAGAAGTCGAAGGCTGATGCATCCTCGGCAGGAACCCC[TC/TT,C]
GCACTTTCGCGCCCATGTCGGTAAGGGCGAGGCGGAGCGTTTGACAAGCAGTTCTCGCGGATTCGGTGGTCTTCGCCATCTCCTGTGAAAACCGCTGCGA

Allele Frequencies:

Populations	Population Size	Frequency of GA(primary allele)	Frequency of AA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.80%	24.50%	1.44%	5.21%	G: 0.11%
All Indica	2759	58.60%	39.00%	0.47%	1.92%	NA
All Japonica	1512	96.00%	3.50%	0.13%	0.40%	NA
Aus	269	15.20%	2.20%	17.10%	63.57%	G: 1.86%
Indica I	595	73.40%	25.00%	0.17%	1.34%	NA
Indica II	465	39.40%	58.70%	0.00%	1.94%	NA
Indica III	913	63.30%	34.90%	0.44%	1.31%	NA
Indica Intermediate	786	53.30%	42.60%	1.02%	3.05%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	89.70%	9.30%	0.00%	0.99%	NA
Japonica Intermediate	241	97.10%	1.70%	0.83%	0.41%	NA
VI/Aromatic	96	79.20%	3.10%	5.21%	12.50%	NA
Intermediate	90	73.30%	20.00%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009321613	GA -> DEL	LOC_Os10g18350.1	N	frameshift_variant	Average:53.398; most accessible tissue: Minghui63 young leaf, score: 72.959	N	N	N	N
vg1009321613	GA -> G	LOC_Os10g18350.1	frameshift_variant ; p.Val740fs; HIGH	frameshift_variant	Average:53.398; most accessible tissue: Minghui63 young leaf, score: 72.959	N	N	N	N
vg1009321613	GA -> AA	LOC_Os10g18350.1	missense_variant ; p.Arg738Gln; MODERATE	nonsynonymous_codon ; R738Q	Average:53.398; most accessible tissue: Minghui63 young leaf, score: 72.959	benign	+1.071	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009321613	5.45E-07	4.38E-11	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	4.99E-07	2.18E-07	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	9.10E-07	NA	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	1.25E-06	NA	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	2.55E-07	NA	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	6.23E-08	9.22E-08	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	NA	9.97E-06	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	2.43E-06	2.22E-06	mr1147	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	NA	3.70E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	NA	1.98E-10	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	NA	4.46E-09	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	NA	3.01E-08	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	2.60E-07	5.22E-10	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	7.57E-07	1.66E-07	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	9.59E-07	NA	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	5.62E-06	NA	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	6.23E-08	3.24E-14	mr1147_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	8.79E-07	1.08E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	1.80E-06	NA	mr1204_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	5.53E-06	9.36E-08	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	NA	9.31E-06	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	NA	7.66E-07	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	NA	6.79E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	NA	1.66E-09	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321613	NA	3.00E-09	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251