\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009321592:

Variant ID: vg1009321592 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9321592
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGCGAGCGCCGCGGAGGAGTCGCAGCGGTTTTCACAGGAGATGGCGAAGACCACCGAATCCGCGAGAACTGCTTGTCAAACGCTCCGCCTCGCCCTTA[C/T]
CGACATGGGCGCGAAAGTGCGAGGGGTTCCTGCCGAGGATGCATCAGCCTTCGACTTCTCCGAGTGGACCCAGCAGGCTGGCGGATCGGTTTCGGACTGC

Reverse complement sequence

GCAGTCCGAAACCGATCCGCCAGCCTGCTGGGTCCACTCGGAGAAGTCGAAGGCTGATGCATCCTCGGCAGGAACCCCTCGCACTTTCGCGCCCATGTCG[G/A]
TAAGGGCGAGGCGGAGCGTTTGACAAGCAGTTCTCGCGGATTCGGTGGTCTTCGCCATCTCCTGTGAAAACCGCTGCGACTCCTCCGCGGCGCTCGCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 24.50% 0.89% 5.59% NA
All Indica  2759 58.60% 39.00% 0.36% 1.96% NA
All Japonica  1512 96.00% 3.50% 0.00% 0.46% NA
Aus  269 19.00% 2.20% 11.90% 66.91% NA
Indica I  595 73.40% 25.00% 0.17% 1.34% NA
Indica II  465 39.40% 58.70% 0.00% 1.94% NA
Indica III  913 63.30% 35.00% 0.33% 1.31% NA
Indica Intermediate  786 53.40% 42.60% 0.76% 3.18% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 89.70% 9.30% 0.00% 0.99% NA
Japonica Intermediate  241 97.50% 1.70% 0.00% 0.83% NA
VI/Aromatic  96 79.20% 3.10% 0.00% 17.71% NA
Intermediate  90 73.30% 20.00% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009321592 C -> T LOC_Os10g18350.1 missense_variant ; p.Thr731Ile; MODERATE nonsynonymous_codon ; T731I Average:51.938; most accessible tissue: Minghui63 young leaf, score: 71.254 benign 0.624 DELETERIOUS 0.05
vg1009321592 C -> DEL LOC_Os10g18350.1 N frameshift_variant Average:51.938; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009321592 NA 9.37E-10 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 NA 3.11E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 3.89E-06 NA mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 7.34E-06 NA mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 2.39E-06 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 8.20E-07 5.30E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 NA 9.73E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 NA 2.81E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 NA 3.88E-11 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 NA 1.06E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 NA 2.16E-08 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 3.33E-07 4.55E-10 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 1.23E-06 1.36E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 3.73E-08 NA mr1128_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 1.86E-07 6.14E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 3.89E-07 1.69E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 6.91E-06 3.44E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 3.28E-06 NA mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 1.68E-06 2.93E-08 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 7.66E-06 7.66E-06 mr1250_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 NA 4.69E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 NA 8.18E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 NA 4.37E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 NA 2.86E-10 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009321592 NA 6.07E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251