\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009318270:

Variant ID: vg1009318270 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9318270
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGCCCCTCACGGGCAAGGGTGAGATTGGAGCTTCGGCCGAGACCGTGCAAACCATGTGGTATGGTATGCGGCGCCCCCTTTCGACCGATTCTCCTGCC[G/A]
AAACCTACACTATTCCTGCGAATGAAGTTTGTTATTTGTGCGGCTGGTATTATTTTGCCGCTCTTCGCCTCCTGCGTTTGGTTGCATATTCATATATATA

Reverse complement sequence

TATATATATGAATATGCAACCAAACGCAGGAGGCGAAGAGCGGCAAAATAATACCAGCCGCACAAATAACAAACTTCATTCGCAGGAATAGTGTAGGTTT[C/T]
GGCAGGAGAATCGGTCGAAAGGGGGCGCCGCATACCATACCACATGGTTTGCACGGTCTCGGCCGAAGCTCCAATCTCACCCTTGCCCGTGAGGGGCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 24.20% 0.63% 2.90% NA
All Indica  2759 58.70% 38.90% 0.83% 1.63% NA
All Japonica  1512 96.20% 3.40% 0.00% 0.33% NA
Aus  269 64.30% 1.90% 1.86% 31.97% NA
Indica I  595 73.10% 25.00% 0.67% 1.18% NA
Indica II  465 40.90% 58.10% 0.86% 0.22% NA
Indica III  913 63.00% 34.70% 0.77% 1.53% NA
Indica Intermediate  786 53.30% 42.70% 1.02% 2.93% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 89.70% 9.30% 0.00% 0.99% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 17.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009318270 G -> A LOC_Os10g18350.1 upstream_gene_variant ; 896.0bp to feature; MODIFIER silent_mutation Average:25.775; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1009318270 G -> A LOC_Os10g18340.1 downstream_gene_variant ; 1923.0bp to feature; MODIFIER silent_mutation Average:25.775; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1009318270 G -> A LOC_Os10g18360.1 downstream_gene_variant ; 4922.0bp to feature; MODIFIER silent_mutation Average:25.775; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1009318270 G -> A LOC_Os10g18340.2 downstream_gene_variant ; 1927.0bp to feature; MODIFIER silent_mutation Average:25.775; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1009318270 G -> A LOC_Os10g18340-LOC_Os10g18350 intergenic_region ; MODIFIER silent_mutation Average:25.775; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1009318270 G -> DEL N N silent_mutation Average:25.775; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009318270 4.64E-08 2.04E-12 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 1.48E-08 1.28E-08 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 4.82E-06 NA mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 3.43E-06 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 2.67E-07 2.13E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 NA 6.87E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 NA 5.79E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 1.46E-06 NA mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 1.66E-07 1.77E-07 mr1147 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 NA 5.40E-06 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 NA 4.94E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 NA 1.13E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 NA 7.42E-11 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 NA 3.40E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 NA 1.35E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 2.36E-06 2.51E-09 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 1.72E-06 2.65E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 2.66E-06 8.22E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 2.88E-06 1.72E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 NA 1.31E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 NA 3.57E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 NA 1.46E-08 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009318270 NA 2.53E-08 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251