Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009316724:

Variant ID: vg1009316724 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9316724
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


AACGTGGCTGCCCCTAGCCACGAATCCAACTAGAACTAGGACTCCTAATCACATAGGAAACCTACCAAACCAGGGAAACAACATCCCCATACAATTCCAC[G/A]
TTCCAATCTTTTCAAACTTGGACTCCAATCCAAATTTGACTACTCTTTCCATACGCACACAACACAACATGTATGTCATATGGAAACCTTCACCTCCACG

Reverse complement sequence

CGTGGAGGTGAAGGTTTCCATATGACATACATGTTGTGTTGTGTGCGTATGGAAAGAGTAGTCAAATTTGGATTGGAGTCCAAGTTTGAAAAGATTGGAA[C/T]
GTGGAATTGTATGGGGATGTTGTTTCCCTGGTTTGGTAGGTTTCCTATGTGATTAGGAGTCCTAGTTCTAGTTGGATTCGTGGCTAGGGGCAGCCACGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 39.90% 0.99% 2.67% NA
All Indica  2759 42.60% 54.50% 1.12% 1.78% NA
All Japonica  1512 76.10% 23.50% 0.13% 0.33% NA
Aus  269 67.30% 1.50% 5.20% 26.02% NA
Indica I  595 27.40% 70.90% 0.50% 1.18% NA
Indica II  465 60.40% 38.30% 0.86% 0.43% NA
Indica III  913 38.30% 58.50% 1.42% 1.75% NA
Indica Intermediate  786 48.50% 47.10% 1.40% 3.05% NA
Temperate Japonica  767 82.40% 17.50% 0.13% 0.00% NA
Tropical Japonica  504 77.00% 21.80% 0.20% 0.99% NA
Japonica Intermediate  241 53.90% 46.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 73.30% 24.40% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009316724 G -> A LOC_Os10g18330.1 upstream_gene_variant ; 3664.0bp to feature; MODIFIER silent_mutation Average:67.34; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N
vg1009316724 G -> A LOC_Os10g18350.1 upstream_gene_variant ; 2442.0bp to feature; MODIFIER silent_mutation Average:67.34; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N
vg1009316724 G -> A LOC_Os10g18340.1 downstream_gene_variant ; 377.0bp to feature; MODIFIER silent_mutation Average:67.34; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N
vg1009316724 G -> A LOC_Os10g18340.2 downstream_gene_variant ; 381.0bp to feature; MODIFIER silent_mutation Average:67.34; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N
vg1009316724 G -> A LOC_Os10g18340-LOC_Os10g18350 intergenic_region ; MODIFIER silent_mutation Average:67.34; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N
vg1009316724 G -> DEL N N silent_mutation Average:67.34; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1009316724 G A -0.06 -0.06 -0.03 -0.04 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009316724 1.08E-06 7.37E-07 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 1.30E-08 NA mr1070 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 1.28E-07 5.79E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 1.40E-06 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 7.02E-08 3.28E-08 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 5.37E-06 6.24E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 NA 5.81E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 NA 7.30E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 NA 2.46E-10 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 NA 7.69E-11 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 NA 4.80E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 6.58E-06 1.50E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 4.35E-06 1.18E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 NA 4.39E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 NA 5.81E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 NA 6.12E-07 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 NA 1.30E-13 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009316724 NA 5.29E-11 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251