Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009312105:

Variant ID: vg1009312105 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9312105
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.10, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

GTATGTAGAAACAATATCCTGCCCTAAGAACTTTAAGAAATCTGGGATCTTATATCAGTTGGGCAATGGCATCTTATCAAAATATTCTGGATATGGGTTC[T/C]
GATACATGATACCGCTGTCTTTTGGCTTGATGCCAAATTGTTCTCTCACCATATTTGCAATCATGCCAGCCAAGGGCTGTTGTTGGATGACCCCTTGGAC

Reverse complement sequence

GTCCAAGGGGTCATCCAACAACAGCCCTTGGCTGGCATGATTGCAAATATGGTGAGAGAACAATTTGGCATCAAGCCAAAAGACAGCGGTATCATGTATC[A/G]
GAACCCATATCCAGAATATTTTGATAAGATGCCATTGCCCAACTGATATAAGATCCCAGATTTCTTAAAGTTCTTAGGGCAGGATATTGTTTCTACATAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.60%	43.90%	0.04%	0.49%	NA
All Indica	2759	56.10%	43.10%	0.07%	0.76%	NA
All Japonica	1512	67.20%	32.70%	0.00%	0.07%	NA
Aus	269	0.00%	100.00%	0.00%	0.00%	NA
Indica I	595	72.30%	27.10%	0.00%	0.67%	NA
Indica II	465	38.90%	59.80%	0.00%	1.29%	NA
Indica III	913	59.90%	39.30%	0.22%	0.55%	NA
Indica Intermediate	786	49.60%	49.60%	0.00%	0.76%	NA
Temperate Japonica	767	72.40%	27.60%	0.00%	0.00%	NA
Tropical Japonica	504	50.20%	49.60%	0.00%	0.20%	NA
Japonica Intermediate	241	86.30%	13.70%	0.00%	0.00%	NA
VI/Aromatic	96	21.90%	78.10%	0.00%	0.00%	NA
Intermediate	90	47.80%	51.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009312105	T -> C	LOC_Os10g18340.1	upstream_gene_variant ; 3351.0bp to feature; MODIFIER	silent_mutation	Average:52.559; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N
vg1009312105	T -> C	LOC_Os10g18340.2	upstream_gene_variant ; 3353.0bp to feature; MODIFIER	silent_mutation	Average:52.559; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N
vg1009312105	T -> C	LOC_Os10g18330.1	downstream_gene_variant ; 206.0bp to feature; MODIFIER	silent_mutation	Average:52.559; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N
vg1009312105	T -> C	LOC_Os10g18310-LOC_Os10g18330	intergenic_region ; MODIFIER	silent_mutation	Average:52.559; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N
vg1009312105	T -> DEL	N	N	silent_mutation	Average:52.559; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009312105	NA	1.11E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	9.01E-06	NA	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	3.90E-06	7.85E-07	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	5.76E-06	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	1.96E-13	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	2.19E-11	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	1.23E-09	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	1.90E-06	2.75E-07	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	4.21E-06	NA	mr1128_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	6.27E-06	1.29E-06	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	3.06E-06	3.37E-06	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	2.67E-11	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	9.34E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	3.90E-06	2.66E-07	mr1204_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	3.15E-06	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	4.97E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	4.21E-06	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	1.22E-20	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	2.74E-12	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	1.82E-09	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	1.91E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	9.89E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009312105	NA	8.77E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251