\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009290716:

Variant ID: vg1009290716 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9290716
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, T: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCAACTTACATTTGAAAACTTTCATCTCCAAATTCAAAACTTTTAACTTAATTAAAAACTTTCAACTGAAATTAAAGGTGATAGATTCAATTTCTAAA[A/T]
TTAAAAAAAGGCAAAATTTGCAACAGGACACTGAAATATTGTGGCCTTTGCTGTGAGACACCCAAAAATCGTGAATCTTTTCGAGAACACTGTAAAAAAG

Reverse complement sequence

CTTTTTTACAGTGTTCTCGAAAAGATTCACGATTTTTGGGTGTCTCACAGCAAAGGCCACAATATTTCAGTGTCCTGTTGCAAATTTTGCCTTTTTTTAA[T/A]
TTTAGAAATTGAATCTATCACCTTTAATTTCAGTTGAAAGTTTTTAATTAAGTTAAAAGTTTTGAATTTGGAGATGAAAGTTTTCAAATGTAAGTTGAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 36.60% 4.85% 4.99% NA
All Indica  2759 43.80% 54.60% 1.09% 0.51% NA
All Japonica  1512 63.50% 13.60% 8.80% 14.15% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 28.70% 70.80% 0.50% 0.00% NA
Indica II  465 61.10% 38.70% 0.00% 0.22% NA
Indica III  913 38.60% 58.50% 1.75% 1.20% NA
Indica Intermediate  786 51.10% 47.20% 1.40% 0.25% NA
Temperate Japonica  767 89.00% 5.30% 0.52% 5.08% NA
Tropical Japonica  504 25.60% 21.00% 22.22% 31.15% NA
Japonica Intermediate  241 61.40% 24.10% 7.05% 7.47% NA
VI/Aromatic  96 40.60% 0.00% 57.29% 2.08% NA
Intermediate  90 63.30% 18.90% 11.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009290716 A -> T LOC_Os10g18260-LOC_Os10g18294 intergenic_region ; MODIFIER silent_mutation Average:27.937; most accessible tissue: Callus, score: 42.884 N N N N
vg1009290716 A -> DEL N N silent_mutation Average:27.937; most accessible tissue: Callus, score: 42.884 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009290716 NA 1.68E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 4.54E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 7.74E-06 7.74E-06 mr1027 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 3.66E-06 1.17E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 9.03E-12 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 6.54E-07 NA mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 1.16E-06 1.22E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 1.32E-06 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 1.27E-07 1.58E-08 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 1.97E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 7.25E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 2.23E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 5.03E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 1.23E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 1.21E-06 1.21E-06 mr1582 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 7.64E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 3.83E-10 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 1.01E-07 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 9.55E-08 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 1.50E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 2.05E-15 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 1.57E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 4.70E-16 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 7.53E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 1.89E-15 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 3.04E-15 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 3.43E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 1.55E-10 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 2.33E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009290716 NA 9.14E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251