\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009283499:

Variant ID: vg1009283499 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9283499
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, C: 0.13, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGTTGAATTTAAAATTGCATGTTTGTGAAGTGATATATTTCATATTAATTTATATTGCTAATTTTTTATATATTTTTTGTGACTATTTAGATGATATG[T/C]
ACGAAACGAGGGGATATCCTCCAGAGATGAATTCACTTTCCCCTGCTAGATGTTGCTTCACAGATCGACCTTGGGCGGCTGGTGCTGCTAGCTGCTTGAC

Reverse complement sequence

GTCAAGCAGCTAGCAGCACCAGCCGCCCAAGGTCGATCTGTGAAGCAACATCTAGCAGGGGAAAGTGAATTCATCTCTGGAGGATATCCCCTCGTTTCGT[A/G]
CATATCATCTAAATAGTCACAAAAAATATATAAAAAATTAGCAATATAAATTAATATGAAATATATCACTTCACAAACATGCAATTTTAAATTCAACTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 37.40% 0.32% 0.06% NA
All Indica  2759 57.70% 41.80% 0.40% 0.11% NA
All Japonica  1512 68.30% 31.50% 0.20% 0.00% NA
Aus  269 62.10% 37.90% 0.00% 0.00% NA
Indica I  595 72.30% 27.20% 0.17% 0.34% NA
Indica II  465 39.80% 59.40% 0.65% 0.22% NA
Indica III  913 61.70% 38.10% 0.22% 0.00% NA
Indica Intermediate  786 52.80% 46.60% 0.64% 0.00% NA
Temperate Japonica  767 73.30% 26.60% 0.13% 0.00% NA
Tropical Japonica  504 50.80% 49.00% 0.20% 0.00% NA
Japonica Intermediate  241 89.20% 10.40% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009283499 T -> C LOC_Os10g18260.1 upstream_gene_variant ; 2856.0bp to feature; MODIFIER silent_mutation Average:60.107; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg1009283499 T -> C LOC_Os10g18260-LOC_Os10g18294 intergenic_region ; MODIFIER silent_mutation Average:60.107; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg1009283499 T -> DEL N N silent_mutation Average:60.107; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009283499 7.52E-06 3.08E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 5.12E-06 1.71E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 8.39E-06 6.55E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 2.12E-06 3.48E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 NA 1.08E-11 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 NA 1.41E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 NA 1.98E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 NA 2.37E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 9.33E-06 5.87E-07 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 1.84E-06 NA mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 NA 1.34E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 NA 5.54E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 NA 3.10E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 6.17E-07 2.01E-08 mr1204_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 NA 1.58E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 6.82E-06 3.28E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 NA 4.14E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 NA 2.91E-15 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 NA 2.11E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283499 NA 2.58E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251