\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009262784:

Variant ID: vg1009262784 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 9262784
Reference Allele: GCCAAlternative Allele: G,ACCA
Primary Allele: ACCASecondary Allele: GCCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTAGCTCTCCTCGCCCTCTTCTCCTCACTTCTTTACACCTTCAACGTGGGCTCGCCCCGCCCTGCCCTCTCACGCTCTCCGTCACCGCCGCCGCCGCC[GCCA/G,ACCA]
TCGCTGTCCTCTCCTCCGATGCCGATCCCGATGCCGCCGCCTCCGTCCAAACTGCCTTGACTGTGTGCCAGGCGTCGGCACAAGCCACCGGTGGTGCTTG

Reverse complement sequence

CAAGCACCACCGGTGGCTTGTGCCGACGCCTGGCACACAGTCAAGGCAGTTTGGACGGAGGCGGCGGCATCGGGATCGGCATCGGAGGAGAGGACAGCGA[TGGC/C,TGGT]
GGCGGCGGCGGCGGTGACGGAGAGCGTGAGAGGGCAGGGCGGGGCGAGCCCACGTTGAAGGTGTAAAGAAGTGAGGAGAAGAGGGCGAGGAGAGCTAGAG

Allele Frequencies:

Populations Population SizeFrequency of ACCA(primary allele) Frequency of GCCA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.10% 24.90% 0.91% 0.00% G: 17.10%
All Indica  2759 67.60% 2.80% 1.30% 0.00% G: 28.34%
All Japonica  1512 28.40% 70.40% 0.26% 0.00% G: 0.99%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 28.60% 2.90% 2.02% 0.00% G: 66.55%
Indica II  465 82.60% 2.40% 1.29% 0.00% G: 13.76%
Indica III  913 82.80% 2.40% 0.55% 0.00% G: 14.24%
Indica Intermediate  786 70.60% 3.30% 1.65% 0.00% G: 24.43%
Temperate Japonica  767 11.70% 86.80% 0.39% 0.00% G: 1.04%
Tropical Japonica  504 50.80% 48.20% 0.00% 0.00% G: 0.99%
Japonica Intermediate  241 34.40% 64.30% 0.41% 0.00% G: 0.83%
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 57.80% 26.70% 3.33% 0.00% G: 12.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009262784 GCCA -> G LOC_Os10g18234.1 disruptive_inframe_deletion ; p.Gly175del; MODERATE inframe_variant Average:69.585; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1009262784 GCCA -> ACCA LOC_Os10g18234.1 synonymous_variant ; p.Gly175Gly; LOW synonymous_codon Average:69.585; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009262784 NA 3.15E-17 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 9.60E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 4.11E-13 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 5.36E-06 6.95E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 1.50E-16 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 8.67E-14 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 1.13E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 3.98E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 2.79E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 5.03E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 1.93E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 6.33E-18 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 3.09E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 9.58E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 3.08E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 7.37E-07 NA mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 2.21E-21 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 8.59E-07 2.13E-07 mr1250_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 3.94E-08 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 2.78E-18 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 6.54E-06 2.88E-12 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 1.34E-06 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 5.61E-08 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 8.67E-06 6.47E-07 mr1849_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 5.57E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 7.58E-08 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009262784 NA 5.39E-07 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251