\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009253419:

Variant ID: vg1009253419 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9253419
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.36, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TAAATGAGGTTAAATCATTCTTGTCTCAAAATTTTGATATGAAGGATTTGGGAGTAGTTGATGTTATCTTAAACATTAAGCTAATTAGAGGTGAGAATGG[A/G]
ATTACACTCTTGCAGTCCCATTATGTGGAGAAGATTTTGAATCGTTTTGGCTACATTGATAGTAAGCCCTCTCCAACACCTTATGATCCTAGCTTGTTGC

Reverse complement sequence

GCAACAAGCTAGGATCATAAGGTGTTGGAGAGGGCTTACTATCAATGTAGCCAAAACGATTCAAAATCTTCTCCACATAATGGGACTGCAAGAGTGTAAT[T/C]
CCATTCTCACCTCTAATTAGCTTAATGTTTAAGATAACATCAACTACTCCCAAATCCTTCATATCAAAATTTTGAGACAAGAATGATTTAACCTCATTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.20% 1.40% 16.84% 57.58% NA
All Indica  2759 3.80% 1.70% 11.16% 83.33% NA
All Japonica  1512 65.60% 0.70% 13.76% 19.91% NA
Aus  269 4.10% 1.90% 66.91% 27.14% NA
Indica I  595 5.50% 0.80% 2.02% 91.60% NA
Indica II  465 2.60% 1.90% 2.80% 92.69% NA
Indica III  913 2.70% 2.10% 20.59% 74.59% NA
Indica Intermediate  786 4.50% 1.80% 12.09% 81.68% NA
Temperate Japonica  767 80.10% 0.30% 4.69% 14.99% NA
Tropical Japonica  504 43.80% 1.00% 24.40% 30.75% NA
Japonica Intermediate  241 65.10% 1.70% 20.33% 12.86% NA
VI/Aromatic  96 3.10% 2.10% 83.33% 11.46% NA
Intermediate  90 36.70% 0.00% 22.22% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009253419 A -> G LOC_Os10g18210.1 synonymous_variant ; p.Gly634Gly; LOW synonymous_codon Average:20.013; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1009253419 A -> DEL LOC_Os10g18210.1 N frameshift_variant Average:20.013; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009253419 NA 2.22E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 3.17E-06 3.17E-06 mr1027 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 1.28E-06 1.00E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 5.16E-06 2.31E-06 mr1152 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 3.05E-06 1.16E-07 mr1154 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 2.79E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 1.67E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 6.90E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 7.07E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 8.79E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 8.24E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 2.29E-07 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 9.46E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 7.29E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 6.42E-08 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 2.33E-06 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 2.47E-13 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 7.23E-07 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 1.27E-10 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 6.17E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 5.11E-08 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 2.62E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 2.67E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009253419 NA 8.93E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251