\
| Variant ID: vg1009252761 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9252761 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 318. )
TTCACTGTGTACCTCATGGATGACACTCCTAAGTCAATTTCAGAAGCATATGCATCTCCTGATGCAGACTACTGGAAGGAGGCTGTCCGTAGTGAAATGG[A/T]
TTCCATTATCACTAACGGGACTTGGGAGGTGACAGAGCGACCCTGTGGGTGTAAACCTGTGGGGTGCAAGTGGGTGTTCAAGAAGAAGCTTAGGCCTGAC
GTCAGGCCTAAGCTTCTTCTTGAACACCCACTTGCACCCCACAGGTTTACACCCACAGGGTCGCTCTGTCACCTCCCAAGTCCCGTTAGTGATAATGGAA[T/A]
CCATTTCACTACGGACAGCCTCCTTCCAGTAGTCTGCATCAGGAGATGCATATGCTTCTGAAATTGACTTAGGAGTGTCATCCATGAGGTACACAGTGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.50% | 24.40% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 60.70% | 39.00% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.50% | 25.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 41.30% | 58.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 65.00% | 34.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 57.00% | 42.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009252761 | A -> T | LOC_Os10g18210.1 | missense_variant ; p.Asp415Val; MODERATE | nonsynonymous_codon ; D415V | Average:29.945; most accessible tissue: Minghui63 young leaf, score: 57.221 | probably damaging |
2.201 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009252761 | 1.66E-06 | 3.32E-11 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009252761 | 1.77E-06 | 1.89E-07 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009252761 | 7.01E-07 | NA | mr1070 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009252761 | 3.10E-07 | 7.71E-07 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009252761 | 4.97E-06 | 1.79E-06 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009252761 | 3.63E-06 | 3.35E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009252761 | NA | 1.07E-07 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009252761 | NA | 5.15E-08 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009252761 | NA | 1.07E-08 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009252761 | NA | 1.29E-06 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009252761 | NA | 2.77E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |