Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009216003:

Variant ID: vg1009216003 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9216003
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAAAAAGGAACTTCCTCTAGACGTTTCCATAGTATATAGCAGGGTTTGCTTTATCGGTTTGTGCTTTTATATCGGGGGTCACCGAAATCCCGAAATTT[T/C]
GGAAATTTCGGTCCGAAATTTCGAAATTTTGAGCAAAATTTAGTTGAATTTGAATAAATATTACCCAAATTTATGAAAATTTTGAAAAATTAAAGAAATT

Reverse complement sequence

AATTTCTTTAATTTTTCAAAATTTTCATAAATTTGGGTAATATTTATTCAAATTCAACTAAATTTTGCTCAAAATTTCGAAATTTCGGACCGAAATTTCC[A/G]
AAATTTCGGGATTTCGGTGACCCCCGATATAAAAGCACAAACCGATAAAGCAAACCCTGCTATATACTATGGAAACGTCTAGAGGAAGTTCCTTTTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.50%	11.50%	0.02%	0.00%	NA
All Indica	2759	96.90%	3.10%	0.00%	0.00%	NA
All Japonica	1512	89.70%	10.30%	0.07%	0.00%	NA
Aus	269	2.60%	97.40%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	97.70%	2.30%	0.00%	0.00%	NA
Indica Intermediate	786	93.60%	6.40%	0.00%	0.00%	NA
Temperate Japonica	767	85.00%	14.90%	0.13%	0.00%	NA
Tropical Japonica	504	93.10%	6.90%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009216003	T -> C	LOC_Os10g18160.1	upstream_gene_variant ; 3355.0bp to feature; MODIFIER	silent_mutation	Average:44.335; most accessible tissue: Callus, score: 82.894	N	N	N	N
vg1009216003	T -> C	LOC_Os10g18150.1	downstream_gene_variant ; 671.0bp to feature; MODIFIER	silent_mutation	Average:44.335; most accessible tissue: Callus, score: 82.894	N	N	N	N
vg1009216003	T -> C	LOC_Os10g18150-LOC_Os10g18160	intergenic_region ; MODIFIER	silent_mutation	Average:44.335; most accessible tissue: Callus, score: 82.894	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009216003	NA	8.89E-06	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	1.07E-13	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	7.40E-16	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	2.85E-13	mr1260	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	2.06E-16	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	3.02E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	2.79E-08	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	2.51E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	6.47E-17	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	3.79E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	9.57E-18	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	1.23E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	1.01E-07	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009216003	NA	6.45E-17	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251