\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009170287:

Variant ID: vg1009170287 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 9170287
Reference Allele: CATAAACTTTCAACTTTTTTATTTAAACTTTCAATTAlternative Allele: TATAAACTTTCAACTTTTTTATTTAAACTTTCAATT,C
Primary Allele: CATAAACTTTCAACTTTTTT ATTTAAACTTTCAATTSecondary Allele: TATAAACTTTCAACTTTTTT ATTTAAACTTTCAATT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATCACGGAGTCGGATTGCTTGCGTGACTGAAGCCGAGTTTAGTCCAACTTTTTCTTTAAACTTTAAACTTTTTCATCACATTAAAACTTTTCTACACA[CATAAACTTTCAACTTTTTTATTTAAACTTTCAATT/TATAAACTTTCAACTTTTTTATTTAAACTTTCAATT,C]
ATAATCAAACTTTTAATTTTGGTGTGGAATTAAACACAGCATGAGATTTGTCTAGGATTTCTTTTTGGATGAATTTGGAAATTGATGGTTTGAGTTCTAG

Reverse complement sequence

CTAGAACTCAAACCATCAATTTCCAAATTCATCCAAAAAGAAATCCTAGACAAATCTCATGCTGTGTTTAATTCCACACCAAAATTAAAAGTTTGATTAT[AATTGAAAGTTTAAATAAAAAAGTTGAAAGTTTATG/AATTGAAAGTTTAAATAAAAAAGTTGAAAGTTTATA,G]
TGTGTAGAAAAGTTTTAATGTGATGAAAAAGTTTAAAGTTTAAAGAAAAAGTTGGACTAAACTCGGCTTCAGTCACGCAAGCAATCCGACTCCGTGATCA

Allele Frequencies:

Populations Population SizeFrequency of CATAAACTTTCAACTTTTTT ATTTAAACTTTCAATT(primary allele) Frequency of TATAAACTTTCAACTTTTTT ATTTAAACTTTCAATT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 23.10% 0.00% 0.00% NA
All Indica  2759 74.90% 25.10% 0.00% 0.00% NA
All Japonica  1512 79.40% 20.60% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 77.20% 22.80% 0.00% 0.00% NA
Indica III  913 55.40% 44.60% 0.00% 0.00% NA
Indica Intermediate  786 78.40% 21.60% 0.00% 0.00% NA
Temperate Japonica  767 95.20% 4.80% 0.00% 0.00% NA
Tropical Japonica  504 60.30% 39.70% 0.00% 0.00% NA
Japonica Intermediate  241 68.90% 31.10% 0.00% 0.00% NA
VI/Aromatic  96 30.20% 69.80% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009170287 CATAAACTTTCAACTTTTTTATTTAAACTTTCAATT -> C LOC_Os10g18080.1 upstream_gene_variant ; 2436.0bp to feature; MODIFIER N Average:72.761; most accessible tissue: Callus, score: 92.759 N N N N
vg1009170287 CATAAACTTTCAACTTTTTTATTTAAACTTTCAATT -> C LOC_Os10g18090.1 upstream_gene_variant ; 531.0bp to feature; MODIFIER N Average:72.761; most accessible tissue: Callus, score: 92.759 N N N N
vg1009170287 CATAAACTTTCAACTTTTTTATTTAAACTTTCAATT -> C LOC_Os10g18084.1 downstream_gene_variant ; 70.0bp to feature; MODIFIER N Average:72.761; most accessible tissue: Callus, score: 92.759 N N N N
vg1009170287 CATAAACTTTCAACTTTTTTATTTAAACTTTCAATT -> C LOC_Os10g18084-LOC_Os10g18090 intergenic_region ; MODIFIER N Average:72.761; most accessible tissue: Callus, score: 92.759 N N N N
vg1009170287 CATAAACTTTCAACTTTTTTATTTAAACTTTCAATT -> TATAAACTTTCAACTTTTTTATTTAAACTT TCAATT LOC_Os10g18080.1 upstream_gene_variant ; 2435.0bp to feature; MODIFIER silent_mutation Average:72.761; most accessible tissue: Callus, score: 92.759 N N N N
vg1009170287 CATAAACTTTCAACTTTTTTATTTAAACTTTCAATT -> TATAAACTTTCAACTTTTTTATTTAAACTT TCAATT LOC_Os10g18090.1 upstream_gene_variant ; 532.0bp to feature; MODIFIER silent_mutation Average:72.761; most accessible tissue: Callus, score: 92.759 N N N N
vg1009170287 CATAAACTTTCAACTTTTTTATTTAAACTTTCAATT -> TATAAACTTTCAACTTTTTTATTTAAACTT TCAATT LOC_Os10g18084.1 downstream_gene_variant ; 69.0bp to feature; MODIFIER silent_mutation Average:72.761; most accessible tissue: Callus, score: 92.759 N N N N
vg1009170287 CATAAACTTTCAACTTTTTTATTTAAACTTTCAATT -> TATAAACTTTCAACTTTTTTATTTAAACTT TCAATT LOC_Os10g18084-LOC_Os10g18090 intergenic_region ; MODIFIER silent_mutation Average:72.761; most accessible tissue: Callus, score: 92.759 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1009170287 CATAA* C 1.0 0.74 0.83 0.47 0.77 0.94
vg1009170287 CATAA* TATAA* -0.03 -0.01 -0.01 -0.03 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009170287 NA 1.49E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1009170287 NA 6.99E-11 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 3.69E-06 9.65E-11 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 1.27E-06 2.89E-10 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 2.04E-07 2.16E-11 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 4.16E-08 1.66E-23 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 3.16E-12 3.40E-23 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 3.45E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 5.27E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 3.24E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 1.17E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 5.14E-07 7.09E-16 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 9.03E-11 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 2.15E-07 5.73E-11 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 1.07E-08 2.78E-27 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 2.69E-12 6.60E-27 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 2.45E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 4.11E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 2.38E-07 1.14E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 8.73E-10 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 6.53E-09 5.14E-17 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 3.87E-07 3.47E-13 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 1.96E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 3.60E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 1.40E-07 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 3.43E-06 7.37E-13 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 1.34E-06 5.01E-14 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 1.35E-06 3.24E-11 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 3.92E-20 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 1.21E-08 2.31E-21 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 5.80E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 1.67E-10 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 6.71E-06 1.27E-12 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 6.69E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 5.98E-10 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 4.95E-06 NA mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 1.84E-07 NA mr1183_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 8.58E-09 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 9.95E-06 5.97E-12 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 8.11E-10 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 1.26E-07 1.45E-09 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 6.95E-08 5.61E-26 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 2.85E-10 1.37E-24 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 3.72E-09 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 7.75E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 4.58E-11 5.55E-23 mr1794_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 1.22E-06 1.65E-16 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 7.03E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 1.50E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 3.84E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009170287 NA 6.21E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251