\
| Variant ID: vg1009165657 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9165657 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTTAATGCTCCATACATGTGTTTAAAGATTCGATGTGACGTTTTTGGGAAAAAAAAATTGGGGAACTAAACCGGGCCTAAATAGGCATACACAAAATGA[T/G]
AAAGCCATTCGCGTATGATTAAAATTTAGTTTAGTTATTACAAACTTAAAAATGGATTTATTTGATATTTTAAAATAACTTATATATAAAAAGTTTTCAC
GTGAAAACTTTTTATATATAAGTTATTTTAAAATATCAAATAAATCCATTTTTAAGTTTGTAATAACTAAACTAAATTTTAATCATACGCGAATGGCTTT[A/C]
TCATTTTGTGTATGCCTATTTAGGCCCGGTTTAGTTCCCCAATTTTTTTTTCCCAAAAACGTCACATCGAATCTTTAAACACATGTATGGAGCATTAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 17.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 47.90% | 52.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 21.50% | 78.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 89.90% | 10.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.00% | 56.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009165657 | T -> G | LOC_Os10g18084.1 | upstream_gene_variant ; 4240.0bp to feature; MODIFIER | silent_mutation | Average:37.086; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1009165657 | T -> G | LOC_Os10g18070.1 | downstream_gene_variant ; 835.0bp to feature; MODIFIER | silent_mutation | Average:37.086; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1009165657 | T -> G | LOC_Os10g18080.1 | downstream_gene_variant ; 1368.0bp to feature; MODIFIER | silent_mutation | Average:37.086; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1009165657 | T -> G | LOC_Os10g18070-LOC_Os10g18080 | intergenic_region ; MODIFIER | silent_mutation | Average:37.086; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009165657 | NA | 5.26E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009165657 | NA | 3.87E-06 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009165657 | 1.03E-09 | 5.25E-25 | mr1768 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009165657 | NA | 9.31E-07 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009165657 | NA | 2.16E-31 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009165657 | NA | 1.68E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009165657 | NA | 7.47E-07 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009165657 | NA | 2.31E-18 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009165657 | NA | 1.67E-31 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009165657 | NA | 9.13E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |