\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009165657:

Variant ID: vg1009165657 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9165657
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTAATGCTCCATACATGTGTTTAAAGATTCGATGTGACGTTTTTGGGAAAAAAAAATTGGGGAACTAAACCGGGCCTAAATAGGCATACACAAAATGA[T/G]
AAAGCCATTCGCGTATGATTAAAATTTAGTTTAGTTATTACAAACTTAAAAATGGATTTATTTGATATTTTAAAATAACTTATATATAAAAAGTTTTCAC

Reverse complement sequence

GTGAAAACTTTTTATATATAAGTTATTTTAAAATATCAAATAAATCCATTTTTAAGTTTGTAATAACTAAACTAAATTTTAATCATACGCGAATGGCTTT[A/C]
TCATTTTGTGTATGCCTATTTAGGCCCGGTTTAGTTCCCCAATTTTTTTTTCCCAAAAACGTCACATCGAATCTTTAAACACATGTATGGAGCATTAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 17.40% 0.04% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 47.90% 52.00% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 21.50% 78.20% 0.26% 0.00% NA
Tropical Japonica  504 89.90% 10.10% 0.00% 0.00% NA
Japonica Intermediate  241 44.00% 56.00% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009165657 T -> G LOC_Os10g18084.1 upstream_gene_variant ; 4240.0bp to feature; MODIFIER silent_mutation Average:37.086; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1009165657 T -> G LOC_Os10g18070.1 downstream_gene_variant ; 835.0bp to feature; MODIFIER silent_mutation Average:37.086; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1009165657 T -> G LOC_Os10g18080.1 downstream_gene_variant ; 1368.0bp to feature; MODIFIER silent_mutation Average:37.086; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1009165657 T -> G LOC_Os10g18070-LOC_Os10g18080 intergenic_region ; MODIFIER silent_mutation Average:37.086; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009165657 NA 5.26E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657 NA 3.87E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657 1.03E-09 5.25E-25 mr1768 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657 NA 9.31E-07 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657 NA 2.16E-31 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657 NA 1.68E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657 NA 7.47E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657 NA 2.31E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657 NA 1.67E-31 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657 NA 9.13E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251