\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009165299:

Variant ID: vg1009165299 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9165299
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTCACTTGTTTTACGACCACCTTGCTGACCTATACAATAGGCCTAGTTCTTCGCGACTGATGAAGAGAAGTATCAAAGCCTTGTTTATTGTTTAGTTC[G/A,T]
CGAAAAGAAAATTTTTGGATGTCACATCGGACATTTGACTAGATGTCAGAAGGGGTTTTCGGACATGAATGAAAAAATTTCATCACTCGCATGGAAACCG

Reverse complement sequence

CGGTTTCCATGCGAGTGATGAAATTTTTTCATTCATGTCCGAAAACCCCTTCTGACATCTAGTCAAATGTCCGATGTGACATCCAAAAATTTTCTTTTCG[C/T,A]
GAACTAAACAATAAACAAGGCTTTGATACTTCTCTTCATCAGTCGCGAAGAACTAGGCCTATTGTATAGGTCAGCAAGGTGGTCGTAAAACAAGTGACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.50% 23.30% 0.15% 0.00% T: 0.02%
All Indica  2759 74.60% 25.20% 0.14% 0.00% NA
All Japonica  1512 76.40% 23.50% 0.00% 0.00% T: 0.07%
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 77.00% 23.00% 0.00% 0.00% NA
Indica III  913 55.40% 44.20% 0.33% 0.00% NA
Indica Intermediate  786 77.60% 22.30% 0.13% 0.00% NA
Temperate Japonica  767 95.20% 4.80% 0.00% 0.00% NA
Tropical Japonica  504 51.00% 48.80% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 69.70% 30.30% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 29.20% 1.04% 0.00% NA
Intermediate  90 77.80% 20.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009165299 G -> T LOC_Os10g18084.1 upstream_gene_variant ; 4598.0bp to feature; MODIFIER silent_mutation Average:48.35; most accessible tissue: Callus, score: 87.606 N N N N
vg1009165299 G -> T LOC_Os10g18070.1 downstream_gene_variant ; 477.0bp to feature; MODIFIER silent_mutation Average:48.35; most accessible tissue: Callus, score: 87.606 N N N N
vg1009165299 G -> T LOC_Os10g18080.1 downstream_gene_variant ; 1726.0bp to feature; MODIFIER silent_mutation Average:48.35; most accessible tissue: Callus, score: 87.606 N N N N
vg1009165299 G -> T LOC_Os10g18070-LOC_Os10g18080 intergenic_region ; MODIFIER silent_mutation Average:48.35; most accessible tissue: Callus, score: 87.606 N N N N
vg1009165299 G -> A LOC_Os10g18084.1 upstream_gene_variant ; 4598.0bp to feature; MODIFIER silent_mutation Average:48.35; most accessible tissue: Callus, score: 87.606 N N N N
vg1009165299 G -> A LOC_Os10g18070.1 downstream_gene_variant ; 477.0bp to feature; MODIFIER silent_mutation Average:48.35; most accessible tissue: Callus, score: 87.606 N N N N
vg1009165299 G -> A LOC_Os10g18080.1 downstream_gene_variant ; 1726.0bp to feature; MODIFIER silent_mutation Average:48.35; most accessible tissue: Callus, score: 87.606 N N N N
vg1009165299 G -> A LOC_Os10g18070-LOC_Os10g18080 intergenic_region ; MODIFIER silent_mutation Average:48.35; most accessible tissue: Callus, score: 87.606 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009165299 NA 8.42E-08 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1009165299 NA 1.69E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 4.47E-06 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 9.17E-06 NA mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 1.38E-07 8.75E-12 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 6.10E-06 NA mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 1.48E-08 8.59E-12 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 1.16E-06 NA mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 2.43E-09 2.94E-13 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 3.22E-06 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 7.67E-10 7.33E-26 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 9.58E-12 3.77E-23 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 2.40E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 6.28E-06 7.34E-10 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 4.83E-06 4.09E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 1.81E-12 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 1.26E-07 3.54E-15 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 1.82E-10 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 4.90E-09 2.08E-12 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 6.06E-12 1.29E-30 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 3.38E-11 1.99E-26 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 7.56E-09 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 2.58E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 1.22E-07 8.41E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 9.31E-10 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 1.27E-10 3.23E-18 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 6.78E-08 4.67E-14 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 7.47E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 1.56E-06 4.89E-08 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 1.20E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 2.17E-08 2.21E-14 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 1.97E-08 5.46E-15 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 2.38E-07 7.26E-12 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 1.28E-07 7.56E-23 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 5.10E-09 4.61E-22 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 1.69E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 2.30E-07 1.28E-11 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 2.36E-08 7.34E-15 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 4.12E-11 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 1.90E-06 NA mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 1.88E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 6.67E-08 6.48E-14 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 4.11E-11 3.91E-12 mr1258_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 2.19E-08 3.92E-10 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 2.21E-10 5.80E-29 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 6.14E-10 5.18E-25 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 4.16E-12 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 4.69E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 5.10E-08 2.25E-20 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 7.17E-16 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 5.76E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 4.07E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 2.34E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 5.20E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165299 NA 1.95E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251