Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009151297:

Variant ID: vg1009151297 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9151297
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

AAAACCTAGACATCAGACCGGCCAAACAGCCCACAAAAGTTTAAATATCTATAGGAAGATTACAGGGCTTCAGCCGATTGAGTTTTTTCATCAGCAACTC[G/A]
CACCACCTCTTCATAGTTACTTGATCATCTTCCTTTAGCAGAATGCACTAGCGTTGTACAAAAGATAAAGATTTGTAAGCAACCTGCAAAGGAGACTTCA

Reverse complement sequence

TGAAGTCTCCTTTGCAGGTTGCTTACAAATCTTTATCTTTTGTACAACGCTAGTGCATTCTGCTAAAGGAAGATGATCAAGTAACTATGAAGAGGTGGTG[C/T]
GAGTTGCTGATGAAAAAACTCAATCGGCTGAAGCCCTGTAATCTTCCTATAGATATTTAAACTTTTGTGGGCTGTTTGGCCGGTCTGATGTCTAGGTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.00%	4.10%	0.87%	0.00%	NA
All Indica	2759	91.60%	7.00%	1.45%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	79.20%	16.10%	4.71%	0.00%	NA
Indica II	465	98.90%	0.90%	0.22%	0.00%	NA
Indica III	913	94.70%	5.10%	0.11%	0.00%	NA
Indica Intermediate	786	93.00%	5.70%	1.27%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009151297	G -> A	LOC_Os10g18060.1	downstream_gene_variant ; 1064.0bp to feature; MODIFIER	silent_mutation	Average:48.912; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg1009151297	G -> A	LOC_Os10g18042-LOC_Os10g18060	intergenic_region ; MODIFIER	silent_mutation	Average:48.912; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009151297	9.44E-08	3.99E-09	mr1053	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	NA	1.57E-07	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	2.01E-08	2.39E-11	mr1070	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	8.04E-11	6.32E-13	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	7.15E-07	4.57E-07	mr1147	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	NA	5.26E-06	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	NA	8.41E-09	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	NA	5.11E-08	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	7.28E-06	NA	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	NA	3.05E-08	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	NA	7.41E-08	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	NA	9.55E-06	mr1959	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	9.19E-06	5.47E-09	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	2.03E-07	6.27E-12	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	NA	6.01E-07	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	NA	5.43E-09	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	NA	6.77E-09	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	NA	7.30E-08	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	5.15E-06	5.15E-06	mr1250_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009151297	NA	7.84E-06	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251