\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009148414:

Variant ID: vg1009148414 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9148414
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTTGTGAGAAAGTAATATGATTATCAATTCTAATATCTTTCACTACCGAAACTCATAACATGTTACTATGCTCTAGTAATAATATTGTTGTAAAAGTA[T/C]
AATAACACGTGACGTTACTGTAGAACACATAAGACATTACTGCACTTTTGGTAGTAACGTCGTAGTAAAATTGTAGTAGACCAGGAATCGAAACAAAAAT

Reverse complement sequence

ATTTTTGTTTCGATTCCTGGTCTACTACAATTTTACTACGACGTTACTACCAAAAGTGCAGTAATGTCTTATGTGTTCTACAGTAACGTCACGTGTTATT[A/G]
TACTTTTACAACAATATTATTACTAGAGCATAGTAACATGTTATGAGTTTCGGTAGTGAAAGATATTAGAATTGATAATCATATTACTTTCTCACAAAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 37.70% 0.38% 3.77% NA
All Indica  2759 60.80% 38.50% 0.33% 0.36% NA
All Japonica  1512 66.70% 23.50% 0.40% 9.33% NA
Aus  269 1.10% 97.80% 0.00% 1.12% NA
Indica I  595 11.40% 88.60% 0.00% 0.00% NA
Indica II  465 82.40% 17.00% 0.65% 0.00% NA
Indica III  913 80.50% 18.80% 0.11% 0.55% NA
Indica Intermediate  786 62.50% 36.30% 0.64% 0.64% NA
Temperate Japonica  767 83.80% 15.80% 0.13% 0.26% NA
Tropical Japonica  504 33.10% 40.90% 0.99% 25.00% NA
Japonica Intermediate  241 82.60% 12.00% 0.00% 5.39% NA
VI/Aromatic  96 15.60% 62.50% 1.04% 20.83% NA
Intermediate  90 46.70% 46.70% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009148414 T -> C LOC_Os10g18042.1 downstream_gene_variant ; 2404.0bp to feature; MODIFIER silent_mutation Average:23.883; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N
vg1009148414 T -> C LOC_Os10g18060.1 downstream_gene_variant ; 3947.0bp to feature; MODIFIER silent_mutation Average:23.883; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N
vg1009148414 T -> C LOC_Os10g18042-LOC_Os10g18060 intergenic_region ; MODIFIER silent_mutation Average:23.883; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N
vg1009148414 T -> DEL N N silent_mutation Average:23.883; most accessible tissue: Minghui63 flag leaf, score: 35.078 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009148414 3.10E-06 6.28E-15 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 9.66E-06 NA mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 1.32E-07 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 6.19E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 3.43E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 3.48E-18 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 6.48E-12 5.82E-23 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 9.80E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 1.63E-06 1.53E-14 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 1.49E-11 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 2.35E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 7.70E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 2.98E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 2.61E-06 1.59E-30 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 8.02E-10 3.90E-28 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 8.22E-12 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 3.35E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 9.86E-09 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 6.60E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 5.33E-08 1.37E-17 mr1794 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 7.86E-07 2.42E-15 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 1.15E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 9.35E-08 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 9.56E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 6.51E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 4.89E-21 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 1.85E-12 1.30E-28 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 3.70E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 3.90E-10 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 8.97E-08 6.81E-16 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 6.68E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 3.38E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 4.60E-07 1.42E-32 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 7.04E-11 7.46E-32 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 9.13E-12 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 2.72E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 8.66E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 2.02E-07 1.01E-31 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 1.44E-07 6.16E-22 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 7.98E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 2.37E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 2.13E-15 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 2.59E-12 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009148414 NA 2.83E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251