\
| Variant ID: vg1009142008 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9142008 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGAGAAACCATCTTTGGTTGGTCGGCCGAAATCCACAATAGTCCTGGATCCATTTAAAACCGGGACTAAAGACGGTTGGTGGCTACAACGGGCATATGTG[A/G]
TCTTTAGTCCCGGTTGGTAATACCAACTGAGACTAAAGATCATCTTTAGTCCCGGTTGTAGAGATGTCAGACGTTGTCAGGGCCCCCGGGATCTTTAGTC
GACTAAAGATCCCGGGGGCCCTGACAACGTCTGACATCTCTACAACCGGGACTAAAGATGATCTTTAGTCTCAGTTGGTATTACCAACCGGGACTAAAGA[T/C]
CACATATGCCCGTTGTAGCCACCAACCGTCTTTAGTCCCGGTTTTAAATGGATCCAGGACTATTGTGGATTTCGGCCGACCAACCAAAGATGGTTTCTCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.50% | 14.30% | 10.71% | 3.49% | NA |
| All Indica | 2759 | 63.20% | 14.60% | 16.42% | 5.73% | NA |
| All Japonica | 1512 | 97.60% | 1.60% | 0.46% | 0.33% | NA |
| Aus | 269 | 3.70% | 81.00% | 15.24% | 0.00% | NA |
| Indica I | 595 | 12.30% | 31.90% | 44.37% | 11.43% | NA |
| Indica II | 465 | 84.10% | 5.60% | 6.67% | 3.66% | NA |
| Indica III | 913 | 83.90% | 7.40% | 5.26% | 3.40% | NA |
| Indica Intermediate | 786 | 65.50% | 15.10% | 13.99% | 5.34% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.26% | 0.39% | NA |
| Tropical Japonica | 504 | 95.00% | 4.00% | 0.60% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 15.60% | 5.56% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009142008 | A -> G | LOC_Os10g18010.1 | upstream_gene_variant ; 2984.0bp to feature; MODIFIER | silent_mutation | Average:56.257; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1009142008 | A -> G | LOC_Os10g18042.1 | upstream_gene_variant ; 1801.0bp to feature; MODIFIER | silent_mutation | Average:56.257; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1009142008 | A -> G | LOC_Os10g18026.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.257; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1009142008 | A -> DEL | N | N | silent_mutation | Average:56.257; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009142008 | NA | 1.20E-14 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 8.70E-09 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 2.52E-08 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 1.01E-07 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 7.11E-24 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | 7.50E-07 | 9.86E-19 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 1.05E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 2.45E-14 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 1.89E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 7.33E-06 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | 5.42E-07 | 9.87E-41 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | 4.30E-07 | 7.86E-25 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 7.45E-16 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 7.36E-09 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 6.32E-08 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 1.71E-10 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | 7.00E-07 | 2.86E-15 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 5.19E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 1.83E-06 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 7.43E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 1.51E-06 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 7.93E-07 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | 7.58E-07 | 9.84E-26 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | 7.75E-11 | 2.07E-24 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 5.53E-08 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 4.99E-08 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | 6.69E-06 | NA | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | 2.02E-06 | 3.25E-15 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 2.46E-06 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | 2.16E-08 | 2.72E-39 | mr1495_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | 1.80E-10 | 1.42E-28 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 1.07E-15 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 1.17E-09 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 2.51E-07 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | 2.18E-07 | 8.15E-24 | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | 8.86E-08 | 1.56E-21 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 1.57E-12 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 6.01E-08 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 1.05E-19 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 5.25E-11 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009142008 | NA | 7.58E-07 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |