\
| Variant ID: vg1009141969 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 9141969 |
| Reference Allele: GGGACTAAAGACGGTTGGTGGCTACAACGGGCATATGT | Alternative Allele: AGGACTAAAGACGGTTGGTGGCTACAACGGGCATATGT,G |
| Primary Allele: GGGACTAAAGACGGTTGGTG GCTACAACGGGCATATGT | Secondary Allele: AGGACTAAAGACGGTTGGTG GCTACAACGGGCATATGT |
Inferred Ancestral Allele: Not determined.
GACGGCCGCTCAAGCTGTATGCCACCAGCCTACACTGGTGGAGAAACCATCTTTGGTTGGTCGGCCGAAATCCACAATAGTCCTGGATCCATTTAAAACC[GGGACTAAAGACGGTTGGTGGCTACAACGGGCATATGT/AGGACTAAAGACGGTTGGTGGCTACAACGGGCATATGT,G]
GATCTTTAGTCCCGGTTGGTAATACCAACTGAGACTAAAGATCATCTTTAGTCCCGGTTGTAGAGATGTCAGACGTTGTCAGGGCCCCCGGGATCTTTAG
CTAAAGATCCCGGGGGCCCTGACAACGTCTGACATCTCTACAACCGGGACTAAAGATGATCTTTAGTCTCAGTTGGTATTACCAACCGGGACTAAAGATC[ACATATGCCCGTTGTAGCCACCAACCGTCTTTAGTCCC/ACATATGCCCGTTGTAGCCACCAACCGTCTTTAGTCCT,C]
GGTTTTAAATGGATCCAGGACTATTGTGGATTTCGGCCGACCAACCAAAGATGGTTTCTCCACCAGTGTAGGCTGGTGGCATACAGCTTGAGCGGCCGTC
| Populations | Population Size | Frequency of GGGACTAAAGACGGTTGGTG GCTACAACGGGCATATGT(primary allele) | Frequency of AGGACTAAAGACGGTTGGTG GCTACAACGGGCATATGT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.50% | 26.60% | 1.42% | 0.51% | G: 0.04% |
| All Indica | 2759 | 74.70% | 22.80% | 1.99% | 0.51% | NA |
| All Japonica | 1512 | 60.60% | 38.20% | 0.53% | 0.66% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 77.20% | 21.10% | 1.51% | 0.22% | NA |
| Indica III | 913 | 55.00% | 40.10% | 3.72% | 1.20% | NA |
| Indica Intermediate | 786 | 78.20% | 19.80% | 1.65% | 0.25% | NA |
| Temperate Japonica | 767 | 89.20% | 10.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 16.70% | 80.60% | 1.59% | 1.19% | NA |
| Japonica Intermediate | 241 | 61.40% | 37.30% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 25.60% | 4.44% | 0.00% | G: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009141969 | GGGACTAAAGACGGTTGGTGGCTACAACGGGCATATGT -> DEL | N | N | silent_mutation | Average:54.309; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1009141969 | GGGACTAAAGACGGTTGGTGGCTACAACGGGCATATGT -> G | LOC_Os10g18010.1 | upstream_gene_variant ; 2946.0bp to feature; MODIFIER | silent_mutation | Average:54.309; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1009141969 | GGGACTAAAGACGGTTGGTGGCTACAACGGGCATATGT -> G | LOC_Os10g18042.1 | upstream_gene_variant ; 1839.0bp to feature; MODIFIER | silent_mutation | Average:54.309; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1009141969 | GGGACTAAAGACGGTTGGTGGCTACAACGGGCATATGT -> G | LOC_Os10g18026.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.309; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1009141969 | GGGACTAAAGACGGTTGGTGGCTACAACGGGCATATGT -> AGGACTAAAGACGGTTGGTGGCTACAACGG GCATATGT | LOC_Os10g18010.1 | upstream_gene_variant ; 2945.0bp to feature; MODIFIER | silent_mutation | Average:54.309; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1009141969 | GGGACTAAAGACGGTTGGTGGCTACAACGGGCATATGT -> AGGACTAAAGACGGTTGGTGGCTACAACGG GCATATGT | LOC_Os10g18042.1 | upstream_gene_variant ; 1840.0bp to feature; MODIFIER | silent_mutation | Average:54.309; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg1009141969 | GGGACTAAAGACGGTTGGTGGCTACAACGGGCATATGT -> AGGACTAAAGACGGTTGGTGGCTACAACGG GCATATGT | LOC_Os10g18026.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.309; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009141969 | 6.76E-06 | NA | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 2.69E-12 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 9.83E-06 | NA | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 3.50E-07 | 2.04E-11 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 9.45E-08 | 5.32E-11 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 1.23E-07 | 1.65E-11 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 8.37E-08 | 2.63E-29 | mr1118 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 4.13E-11 | 6.04E-22 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 1.39E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 1.78E-08 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 1.15E-07 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 2.24E-11 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 9.46E-09 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 9.69E-08 | 2.26E-11 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 6.17E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 7.47E-08 | 1.86E-32 | mr1495 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 8.44E-12 | 7.33E-25 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 2.42E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 3.65E-08 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 4.98E-06 | 2.98E-11 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 2.02E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 2.38E-07 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 5.28E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 1.91E-10 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 1.95E-06 | 3.07E-12 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 6.58E-07 | 3.72E-13 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 9.00E-06 | 3.16E-10 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 1.47E-23 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 3.64E-10 | 1.01E-21 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 1.58E-09 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 1.26E-06 | 1.64E-13 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 9.31E-07 | 5.31E-12 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 1.76E-06 | 9.78E-13 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 1.17E-07 | NA | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 5.77E-07 | 5.29E-09 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 2.76E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 1.63E-07 | 2.04E-29 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 1.08E-11 | 2.00E-24 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 3.26E-06 | NA | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | 5.38E-06 | 2.56E-15 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 1.94E-06 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 4.19E-06 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009141969 | NA | 1.83E-07 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |