\
| Variant ID: vg1009130986 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9130986 |
| Reference Allele: T | Alternative Allele: A,G |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 313. )
TCTCCACCGAGACTATGCTAGAAACCCACTCCGCATAACGGCATGGCCTAATAAACCCCGCCTTCAACAACCGATCAATCTCCTCTTTGACTCGGTCATA[T/A,G]
AGCAAAGGATTAAAATGACGAGGTGGTTGCTTATAAGGCCTAAAACCCGGTTTAATTGGAAGCCGATGCTCAACAAGCTCACGGCTAAGACCCGGCATCT
AGATGCCGGGTCTTAGCCGTGAGCTTGTTGAGCATCGGCTTCCAATTAAACCGGGTTTTAGGCCTTATAAGCAACCACCTCGTCATTTTAATCCTTTGCT[A/T,C]
TATGACCGAGTCAAAGAGGAGATTGATCGGTTGTTGAAGGCGGGGTTTATTAGGCCATGCCGTTATGCGGAGTGGGTTTCTAGCATAGTCTCGGTGGAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 6.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.20% | 18.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 65.40% | 34.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009130986 | T -> G | LOC_Os10g17990.1 | upstream_gene_variant ; 4460.0bp to feature; MODIFIER | N | Average:28.575; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| vg1009130986 | T -> G | LOC_Os10g17990-LOC_Os10g18010 | intergenic_region ; MODIFIER | N | Average:28.575; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| vg1009130986 | T -> A | LOC_Os10g17990.1 | upstream_gene_variant ; 4460.0bp to feature; MODIFIER | silent_mutation | Average:28.575; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| vg1009130986 | T -> A | LOC_Os10g17990-LOC_Os10g18010 | intergenic_region ; MODIFIER | silent_mutation | Average:28.575; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009130986 | NA | 1.45E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | NA | 4.15E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | 8.35E-08 | 2.53E-21 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | NA | 1.42E-06 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | 9.34E-06 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | NA | 2.40E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | NA | 1.21E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | 3.26E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | NA | 6.17E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | NA | 1.46E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | NA | 2.98E-06 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | 1.82E-06 | NA | mr1922 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | NA | 1.19E-08 | mr1922 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | 4.79E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | NA | 3.84E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | NA | 4.16E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | 5.94E-06 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | 8.67E-06 | 1.00E-07 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | NA | 2.97E-09 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009130986 | NA | 6.02E-07 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |