\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009130355:

Variant ID: vg1009130355 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9130355
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TCGATTTTACCCGCTAGGTTAAAAATAAATCTTCTCAAATAATTCACCATACCTAGCAACTTTTGAACTTCCTTCTTACATATCGGCGCTTTGAAATCAC[G/A]
AATTTTTTCTATCTTCTTAGGGTAAATCTCAACTCCTCTCTCATGCACCATGAATCCTAAGAATCTCCCCGCCGACACACCAAAAGCACATTTAAGTGGG

Reverse complement sequence

CCCACTTAAATGTGCTTTTGGTGTGTCGGCGGGGAGATTCTTAGGATTCATGGTGCATGAGAGAGGAGTTGAGATTTACCCTAAGAAGATAGAAAAAATT[C/T]
GTGATTTCAAAGCGCCGATATGTAAGAAGGAAGTTCAAAAGTTGCTAGGTATGGTGAATTATTTGAGAAGATTTATTTTTAACCTAGCGGGTAAAATCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.80% 46.70% 0.42% 0.00% NA
All Indica  2759 63.10% 36.20% 0.65% 0.00% NA
All Japonica  1512 26.10% 73.90% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 12.80% 86.90% 0.34% 0.00% NA
Indica II  465 82.20% 16.80% 1.08% 0.00% NA
Indica III  913 82.10% 17.50% 0.33% 0.00% NA
Indica Intermediate  786 67.80% 31.20% 1.02% 0.00% NA
Temperate Japonica  767 5.50% 94.50% 0.00% 0.00% NA
Tropical Japonica  504 53.80% 46.20% 0.00% 0.00% NA
Japonica Intermediate  241 33.60% 66.40% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 47.80% 50.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009130355 G -> A LOC_Os10g17990.1 upstream_gene_variant ; 3829.0bp to feature; MODIFIER silent_mutation Average:24.75; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N
vg1009130355 G -> A LOC_Os10g17990-LOC_Os10g18010 intergenic_region ; MODIFIER silent_mutation Average:24.75; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009130355 1.74E-08 NA mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 2.00E-09 3.77E-23 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 7.28E-06 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 2.57E-07 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 5.45E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 5.13E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 3.62E-11 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 1.32E-12 1.68E-24 mr1118 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 1.14E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 1.33E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 6.42E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 1.41E-08 NA mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 1.20E-09 3.05E-22 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 5.18E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 1.21E-10 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 7.59E-11 1.26E-28 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 2.90E-09 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 1.17E-11 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 2.15E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 5.01E-08 1.19E-12 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 2.70E-06 1.96E-12 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 2.08E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 1.48E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 1.46E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 1.78E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 4.66E-09 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 8.38E-12 5.06E-31 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 6.60E-08 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 5.08E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 1.45E-08 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 4.36E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 5.31E-09 NA mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 9.40E-10 1.61E-23 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 4.59E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 1.55E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 2.16E-10 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 2.04E-10 1.45E-32 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 3.75E-13 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 1.35E-11 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 2.65E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 5.13E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 4.53E-07 NA mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 1.36E-15 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 9.50E-06 3.90E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 6.12E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 7.63E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 5.50E-12 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 2.73E-07 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 4.41E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009130355 NA 5.28E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251