Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009060641:

Variant ID: vg1009060641 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9060641
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CTTCAGAATCACCCTATTCTTCTTTATCCTGCGCAATTCATGAAGTGTTTCATGCAGAATTACCACTCCTTCCATAATATTCCTTTCTGGCAAGAAAGCT[G/A]
TGTGTGAAGGTTTAATGACCTTCTAAGCCTATTTGTAAACAAACATTCAACAGACAAATAGGCCTATGCTATTGAATCCTACTGGCGTCCTTTTGCTTGG

Reverse complement sequence

CCAAGCAAAAGGACGCCAGTAGGATTCAATAGCATAGGCCTATTTGTCTGTTGAATGTTTGTTTACAAATAGGCTTAGAAGGTCATTAAACCTTCACACA[C/T]
AGCTTTCTTGCCAGAAAGGAATATTATGGAAGGAGTGGTAATTCTGCATGAAACACTTCATGAATTGCGCAGGATAAAGAAGAATAGGGTGATTCTGAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	24.60%	0.28%	0.04%	NA
All Indica	2759	64.70%	34.70%	0.47%	0.07%	NA
All Japonica	1512	89.40%	10.60%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	13.40%	86.40%	0.17%	0.00%	NA
Indica II	465	83.70%	15.50%	0.86%	0.00%	NA
Indica III	913	84.80%	14.80%	0.33%	0.11%	NA
Indica Intermediate	786	69.10%	30.20%	0.64%	0.13%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	72.60%	27.40%	0.00%	0.00%	NA
Japonica Intermediate	241	93.80%	6.20%	0.00%	0.00%	NA
VI/Aromatic	96	77.10%	22.90%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009060641	G -> A	LOC_Os10g17910.1	downstream_gene_variant ; 3165.0bp to feature; MODIFIER	silent_mutation	Average:32.0; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N
vg1009060641	G -> A	LOC_Os10g17930.1	downstream_gene_variant ; 2042.0bp to feature; MODIFIER	silent_mutation	Average:32.0; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N
vg1009060641	G -> A	LOC_Os10g17920.1	intron_variant ; MODIFIER	silent_mutation	Average:32.0; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N
vg1009060641	G -> DEL	N	N	silent_mutation	Average:32.0; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009060641	4.71E-07	2.37E-20	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	2.17E-07	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	8.33E-08	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	1.65E-06	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	7.90E-10	9.98E-22	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	2.93E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	6.36E-06	NA	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	3.98E-08	6.83E-20	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	8.80E-06	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	6.29E-08	2.21E-25	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	4.38E-09	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	6.54E-06	2.05E-11	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	3.89E-06	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	1.26E-11	1.18E-29	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	1.31E-06	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	1.47E-09	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	4.25E-07	NA	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	4.22E-07	1.32E-20	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	3.91E-07	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	1.45E-06	NA	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	1.07E-11	3.12E-31	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	7.44E-12	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	9.65E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	1.57E-13	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	1.89E-12	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	6.24E-08	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	3.45E-06	7.97E-13	mr1936_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009060641	NA	7.63E-07	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251