\
| Variant ID: vg1009060641 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9060641 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )
CTTCAGAATCACCCTATTCTTCTTTATCCTGCGCAATTCATGAAGTGTTTCATGCAGAATTACCACTCCTTCCATAATATTCCTTTCTGGCAAGAAAGCT[G/A]
TGTGTGAAGGTTTAATGACCTTCTAAGCCTATTTGTAAACAAACATTCAACAGACAAATAGGCCTATGCTATTGAATCCTACTGGCGTCCTTTTGCTTGG
CCAAGCAAAAGGACGCCAGTAGGATTCAATAGCATAGGCCTATTTGTCTGTTGAATGTTTGTTTACAAATAGGCTTAGAAGGTCATTAAACCTTCACACA[C/T]
AGCTTTCTTGCCAGAAAGGAATATTATGGAAGGAGTGGTAATTCTGCATGAAACACTTCATGAATTGCGCAGGATAAAGAAGAATAGGGTGATTCTGAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.10% | 24.60% | 0.28% | 0.04% | NA |
| All Indica | 2759 | 64.70% | 34.70% | 0.47% | 0.07% | NA |
| All Japonica | 1512 | 89.40% | 10.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 13.40% | 86.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 83.70% | 15.50% | 0.86% | 0.00% | NA |
| Indica III | 913 | 84.80% | 14.80% | 0.33% | 0.11% | NA |
| Indica Intermediate | 786 | 69.10% | 30.20% | 0.64% | 0.13% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 72.60% | 27.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009060641 | G -> A | LOC_Os10g17910.1 | downstream_gene_variant ; 3165.0bp to feature; MODIFIER | silent_mutation | Average:32.0; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
| vg1009060641 | G -> A | LOC_Os10g17930.1 | downstream_gene_variant ; 2042.0bp to feature; MODIFIER | silent_mutation | Average:32.0; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
| vg1009060641 | G -> A | LOC_Os10g17920.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.0; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
| vg1009060641 | G -> DEL | N | N | silent_mutation | Average:32.0; most accessible tissue: Zhenshan97 young leaf, score: 67.83 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009060641 | 4.71E-07 | 2.37E-20 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 2.17E-07 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 8.33E-08 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 1.65E-06 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | 7.90E-10 | 9.98E-22 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 2.93E-07 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | 6.36E-06 | NA | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | 3.98E-08 | 6.83E-20 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 8.80E-06 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | 6.29E-08 | 2.21E-25 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 4.38E-09 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | 6.54E-06 | 2.05E-11 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 3.89E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | 1.26E-11 | 1.18E-29 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 1.31E-06 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 1.47E-09 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | 4.25E-07 | NA | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | 4.22E-07 | 1.32E-20 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 3.91E-07 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | 1.45E-06 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | 1.07E-11 | 3.12E-31 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 7.44E-12 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 9.65E-07 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 1.57E-13 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 1.89E-12 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 6.24E-08 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | 3.45E-06 | 7.97E-13 | mr1936_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009060641 | NA | 7.63E-07 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |