Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008991063:

Variant ID: vg1008991063 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 8991063
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

AGATGATAAAACATGCTTAATATTTTATGCGTGACTTGTCTTTTTATTTTTTTCATAATTTTTTTAAATAAGACGGACGGTCAAATATTGGGCACGGAAA[C/T]
CAGGGTTTATCTTTTTTTGGACGGAGGGAGTATATGTACCTAATCTATACCTATATAGACCTAATCTAGACCTGTCAATTAACCTCATCAGGGATCAGGG

Reverse complement sequence

CCCTGATCCCTGATGAGGTTAATTGACAGGTCTAGATTAGGTCTATATAGGTATAGATTAGGTACATATACTCCCTCCGTCCAAAAAAAGATAAACCCTG[G/A]
TTTCCGTGCCCAATATTTGACCGTCCGTCTTATTTAAAAAAATTATGAAAAAAATAAAAAGACAAGTCACGCATAAAATATTAAGCATGTTTTATCATCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.40%	19.40%	0.28%	0.00%	NA
All Indica	2759	74.60%	25.00%	0.40%	0.00%	NA
All Japonica	1512	86.10%	13.80%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	75.70%	23.40%	0.86%	0.00%	NA
Indica III	913	55.60%	43.80%	0.55%	0.00%	NA
Indica Intermediate	786	78.10%	21.60%	0.25%	0.00%	NA
Temperate Japonica	767	95.20%	4.80%	0.00%	0.00%	NA
Tropical Japonica	504	77.40%	22.40%	0.20%	0.00%	NA
Japonica Intermediate	241	75.50%	24.50%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1008991063	C -> T	LOC_Os10g17750.1	upstream_gene_variant ; 4600.0bp to feature; MODIFIER	silent_mutation	Average:62.5; most accessible tissue: Minghui63 root, score: 90.686	N	N	N	N
vg1008991063	C -> T	LOC_Os10g17770.1	upstream_gene_variant ; 1231.0bp to feature; MODIFIER	silent_mutation	Average:62.5; most accessible tissue: Minghui63 root, score: 90.686	N	N	N	N
vg1008991063	C -> T	LOC_Os10g17750-LOC_Os10g17770	intergenic_region ; MODIFIER	silent_mutation	Average:62.5; most accessible tissue: Minghui63 root, score: 90.686	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1008991063	NA	2.03E-12	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	8.84E-10	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	3.01E-09	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	2.57E-06	NA	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	1.17E-06	4.02E-11	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	2.52E-07	1.37E-15	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	2.26E-12	1.11E-23	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	1.47E-09	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	1.81E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	7.43E-06	1.56E-12	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	1.21E-08	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	1.59E-07	2.92E-11	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	8.33E-08	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	6.49E-10	8.83E-24	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	1.01E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	3.26E-07	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	3.33E-08	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	2.87E-07	2.55E-15	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	1.09E-07	2.54E-13	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	9.69E-06	2.85E-07	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	5.60E-06	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	1.78E-06	2.34E-12	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	3.36E-06	8.52E-13	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	5.09E-07	9.27E-12	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	8.95E-07	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	2.68E-09	3.48E-21	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	2.78E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	6.01E-07	1.76E-11	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	9.78E-08	1.96E-14	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	2.48E-10	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	1.67E-07	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	1.78E-07	5.97E-14	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	2.07E-09	NA	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	1.76E-09	2.87E-11	mr1258_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	1.31E-07	NA	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	8.91E-09	8.93E-22	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	2.21E-08	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	1.35E-06	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	2.51E-07	2.09E-19	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	7.39E-06	9.73E-15	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008991063	NA	8.76E-07	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251