\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008978200:

Variant ID: vg1008978200 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8978200
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGGCCGGTCCTGGACGGGGATTTTAATGCACATTCTACTTGGAATTCTATTCGGGAATTTCTGGGCGTGACATTAGATTAGCTAAGGCATCTACCATC[C/T]
TGAAAAGTGTTTAATTGCTTGATTGTCTAGACTGTATGCTTCTTTCATACTTTGAGATGTATCATCCCTAGTCGTGTTTAAAACCATTCAAACCAGCTTG

Reverse complement sequence

CAAGCTGGTTTGAATGGTTTTAAACACGACTAGGGATGATACATCTCAAAGTATGAAAGAAGCATACAGTCTAGACAATCAAGCAATTAAACACTTTTCA[G/A]
GATGGTAGATGCCTTAGCTAATCTAATGTCACGCCCAGAAATTCCCGAATAGAATTCCAAGTAGAATGTGCATTAAAATCCCCGTCCAGGACCGGCCGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 10.20% 2.26% 0.76% NA
All Indica  2759 77.90% 17.20% 3.59% 1.27% NA
All Japonica  1512 99.50% 0.10% 0.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 0.50% 0.67% 0.00% NA
Indica II  465 78.90% 15.10% 5.59% 0.43% NA
Indica III  913 60.50% 33.30% 3.94% 2.30% NA
Indica Intermediate  786 81.80% 12.50% 4.20% 1.53% NA
Temperate Japonica  767 99.60% 0.00% 0.39% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.40% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008978200 C -> T LOC_Os10g17740.1 upstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:45.05; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg1008978200 C -> T LOC_Os10g17724-LOC_Os10g17740 intergenic_region ; MODIFIER silent_mutation Average:45.05; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg1008978200 C -> DEL N N silent_mutation Average:45.05; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008978200 NA 1.33E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1008978200 NA 5.94E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 3.53E-08 6.75E-12 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 5.43E-09 1.73E-11 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 4.94E-08 1.04E-11 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 2.56E-06 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 8.73E-07 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 2.82E-11 3.59E-21 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 4.31E-06 1.05E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 1.97E-06 3.20E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 1.10E-09 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 1.72E-07 8.92E-18 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 5.79E-08 9.32E-11 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 3.15E-08 3.30E-11 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 2.43E-07 NA mr1495 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 2.01E-11 1.95E-24 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 1.68E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 1.09E-07 7.18E-17 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 3.48E-08 6.05E-10 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 8.96E-07 4.01E-16 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 3.07E-07 3.79E-12 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 4.74E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 1.24E-06 3.83E-08 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 1.55E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 1.04E-10 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 1.18E-11 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 3.23E-09 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 4.81E-09 3.13E-20 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 7.69E-09 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 1.69E-11 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 3.05E-10 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 5.77E-10 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 9.68E-08 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 2.08E-06 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 5.58E-10 1.48E-23 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 6.54E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 3.64E-17 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 7.53E-13 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 9.30E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008978200 NA 6.09E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251