\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008921522:

Variant ID: vg1008921522 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8921522
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CTAACGGTTTTGCAAACCAGTATATACCTAATTAAGTTTGGTAAAAACAAAAAAGAAAAACATGCAAACAGGATAATCTTAAAGTGTTGTAATGGTCCCT[G/A]
ATACAATACTAGGAGATATTTTGGACATTTACCTTATTTGGAAAATCTACAAATACAAAAAAAATTGCTGCAAACTTCTTACAAAATACTGGTGGCAAAT

Reverse complement sequence

ATTTGCCACCAGTATTTTGTAAGAAGTTTGCAGCAATTTTTTTTGTATTTGTAGATTTTCCAAATAAGGTAAATGTCCAAAATATCTCCTAGTATTGTAT[C/T]
AGGGACCATTACAACACTTTAAGATTATCCTGTTTGCATGTTTTTCTTTTTTGTTTTTACCAAACTTAATTAGGTATATACTGGTTTGCAAAACCGTTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 1.10% 1.44% 0.00% NA
All Indica  2759 95.80% 1.90% 2.36% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.50% 6.20% 9.24% 0.00% NA
Indica II  465 98.90% 0.60% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 1.50% 1.02% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008921522 G -> A LOC_Os10g17640.1 upstream_gene_variant ; 4188.0bp to feature; MODIFIER silent_mutation Average:38.54; most accessible tissue: Callus, score: 74.418 N N N N
vg1008921522 G -> A LOC_Os10g17650.1 intron_variant ; MODIFIER silent_mutation Average:38.54; most accessible tissue: Callus, score: 74.418 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008921522 9.40E-07 4.03E-08 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 9.04E-08 2.35E-10 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 4.62E-11 5.73E-13 mr1128 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 4.39E-06 2.35E-06 mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 NA 7.93E-08 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 NA 2.97E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 NA 3.15E-06 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 NA 2.17E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 4.70E-06 3.00E-09 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 3.57E-08 1.92E-12 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 NA 1.18E-07 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 NA 2.76E-08 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 NA 5.60E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 NA 7.40E-08 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 1.40E-06 1.40E-06 mr1250_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008921522 NA 8.86E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251