\
| Variant ID: vg1008921522 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8921522 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )
CTAACGGTTTTGCAAACCAGTATATACCTAATTAAGTTTGGTAAAAACAAAAAAGAAAAACATGCAAACAGGATAATCTTAAAGTGTTGTAATGGTCCCT[G/A]
ATACAATACTAGGAGATATTTTGGACATTTACCTTATTTGGAAAATCTACAAATACAAAAAAAATTGCTGCAAACTTCTTACAAAATACTGGTGGCAAAT
ATTTGCCACCAGTATTTTGTAAGAAGTTTGCAGCAATTTTTTTTGTATTTGTAGATTTTCCAAATAAGGTAAATGTCCAAAATATCTCCTAGTATTGTAT[C/T]
AGGGACCATTACAACACTTTAAGATTATCCTGTTTGCATGTTTTTCTTTTTTGTTTTTACCAAACTTAATTAGGTATATACTGGTTTGCAAAACCGTTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 1.10% | 1.44% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 1.90% | 2.36% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.50% | 6.20% | 9.24% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.60% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 1.50% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008921522 | G -> A | LOC_Os10g17640.1 | upstream_gene_variant ; 4188.0bp to feature; MODIFIER | silent_mutation | Average:38.54; most accessible tissue: Callus, score: 74.418 | N | N | N | N |
| vg1008921522 | G -> A | LOC_Os10g17650.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.54; most accessible tissue: Callus, score: 74.418 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008921522 | 9.40E-07 | 4.03E-08 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | 9.04E-08 | 2.35E-10 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | 4.62E-11 | 5.73E-13 | mr1128 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | 4.39E-06 | 2.35E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | NA | 7.93E-08 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | NA | 2.97E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | NA | 3.15E-06 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | NA | 2.17E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | 4.70E-06 | 3.00E-09 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | 3.57E-08 | 1.92E-12 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | NA | 1.18E-07 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | NA | 2.76E-08 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | NA | 5.60E-08 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | NA | 7.40E-08 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | 1.40E-06 | 1.40E-06 | mr1250_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008921522 | NA | 8.86E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |