\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1008918089:

Variant ID: vg1008918089 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 8918089
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.14, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTGCCAATGCCAGAGAGGTACGATGACCAACGACAAAGGGGCAGGAGCAGCAGAGGGGAGCCCTAGTACCCCGCCACCAACACGCTGGCCAGCGCGCC[A/G]
CAGGAGTAGCCTCCTGCGCGCCAGTGAGATCCACCGTCGACACTACCCGGCCCCTGTCAGAACAAGGTAGGGCAGCCAGATCTAGCAGATCTAGATCTGG

Reverse complement sequence

CCAGATCTAGATCTGCTAGATCTGGCTGCCCTACCTTGTTCTGACAGGGGCCGGGTAGTGTCGACGGTGGATCTCACTGGCGCGCAGGAGGCTACTCCTG[T/C]
GGCGCGCTGGCCAGCGTGTTGGTGGCGGGGTACTAGGGCTCCCCTCTGCTGCTCCTGCCCCTTTGTCGTTGGTCATCGTACCTCTCTGGCATTGGCACTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 40.40% 0.30% 0.06% NA
All Indica  2759 71.00% 28.60% 0.29% 0.11% NA
All Japonica  1512 47.60% 52.20% 0.13% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 96.10% 3.70% 0.17% 0.00% NA
Indica II  465 74.60% 24.30% 0.65% 0.43% NA
Indica III  913 52.20% 47.50% 0.22% 0.00% NA
Indica Intermediate  786 71.80% 27.90% 0.25% 0.13% NA
Temperate Japonica  767 42.20% 57.60% 0.13% 0.00% NA
Tropical Japonica  504 68.10% 31.70% 0.20% 0.00% NA
Japonica Intermediate  241 22.00% 78.00% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 53.30% 42.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1008918089 A -> G LOC_Os10g17640.1 upstream_gene_variant ; 755.0bp to feature; MODIFIER silent_mutation Average:71.338; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg1008918089 A -> G LOC_Os10g17650.1 upstream_gene_variant ; 2172.0bp to feature; MODIFIER silent_mutation Average:71.338; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg1008918089 A -> G LOC_Os10g17640-LOC_Os10g17650 intergenic_region ; MODIFIER silent_mutation Average:71.338; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N
vg1008918089 A -> DEL N N silent_mutation Average:71.338; most accessible tissue: Zhenshan97 young leaf, score: 90.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1008918089 5.39E-10 9.25E-20 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 7.35E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 9.65E-07 4.33E-10 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 5.45E-08 1.49E-10 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 4.63E-08 6.98E-11 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 1.15E-13 8.93E-26 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 1.56E-06 1.65E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 5.84E-06 8.85E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 5.17E-07 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 2.33E-09 1.84E-18 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 3.47E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 6.13E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 1.03E-07 2.14E-10 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 3.25E-06 6.46E-10 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 3.46E-06 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 4.84E-14 2.81E-28 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 2.01E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 9.05E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 1.43E-06 1.81E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 3.48E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 2.99E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 4.56E-07 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 3.99E-10 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 4.92E-08 1.90E-12 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 1.42E-08 2.11E-13 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 2.15E-06 3.04E-10 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 8.31E-13 6.82E-28 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 3.96E-06 5.04E-10 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 6.94E-08 3.20E-14 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 7.21E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 4.09E-06 NA mr1161_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 2.74E-09 6.63E-18 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 4.36E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 2.23E-10 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 4.03E-07 1.31E-12 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 7.86E-08 3.18E-09 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 8.05E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 2.61E-07 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 7.17E-14 2.79E-29 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 3.39E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 8.76E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 1.11E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 6.06E-12 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 1.69E-15 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 4.35E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 4.46E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1008918089 NA 1.67E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251