Search for Variation information by Variation ID:
Detailed information for vg1008865540:
| Variant ID: vg1008865540 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8865540 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GTGGCACGCGGTTTCGTGCAGCAGGAGGGGATCGACTACGACGATGCCTTCGCTCCCGTGGCACGGATGGAGTCCGTGCGACTCCTTCTTGCGCTGGCTG[C/T]
TCAGGAAGGCCGGGGCATCCATCACATGGACGTCAAGTCGGCGTTTCTAAACAGCGACTTGAAGGAGGAGGTCTACGTGCACCAGCCGCCGGGATTTGTG
Reverse complement sequence
CACAAATCCCGGCGGCTGGTGCACGTAGACCTCCTCCTTCAAGTCGCTGTTTAGAAACGCCGACTTGACGTCCATGTGATGGATGCCCCGGCCTTCCTGA[G/A]
CAGCCAGCGCAAGAAGGAGTCGCACGGACTCCATCCGTGCCACGGGAGCGAAGGCATCGTCGTAGTCGATCCCCTCCTGCTGCACGAAACCGCGTGCCAC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 13.60% | 0.20% | 9.67% | 76.51% | NA |
| All Indica | 2759 | 1.50% | 0.30% | 8.88% | 89.31% | NA |
| All Japonica | 1512 | 38.60% | 0.00% | 2.45% | 58.99% | NA |
| Aus | 269 | 0.70% | 0.00% | 56.13% | 43.12% | NA |
| Indica I | 595 | 0.80% | 0.00% | 3.53% | 95.63% | NA |
| Indica II | 465 | 1.90% | 0.40% | 9.03% | 88.60% | NA |
| Indica III | 913 | 1.30% | 0.40% | 9.09% | 89.16% | NA |
| Indica Intermediate | 786 | 2.00% | 0.30% | 12.60% | 85.11% | NA |
| Temperate Japonica | 767 | 54.00% | 0.00% | 1.56% | 44.46% | NA |
| Tropical Japonica | 504 | 8.50% | 0.00% | 3.57% | 87.90% | NA |
| Japonica Intermediate | 241 | 52.30% | 0.00% | 2.90% | 44.81% | NA |
| VI/Aromatic | 96 | 0.00% | 0.00% | 12.50% | 87.50% | NA |
| Intermediate | 90 | 20.00% | 0.00% | 13.33% | 66.67% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008865540 | C -> T | LOC_Os10g17570.1 | missense_variant ; p.Ala557Val; MODERATE | nonsynonymous_codon ; A557V | Average:7.973; most accessible tissue: Callus, score: 26.339 | possibly damaging  |
1.985 |
DELETERIOUS | 0.04 |
| vg1008865540 | C -> DEL | LOC_Os10g17570.1 | N | frameshift_variant | Average:7.973; most accessible tissue: Callus, score: 26.339 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008865540 | NA | 4.64E-07 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008865540 | NA | 2.08E-07 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008865540 | 5.99E-06 | NA | mr1129 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008865540 | NA | 1.03E-07 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008865540 | NA | 2.62E-06 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008865540 | 6.19E-07 | NA | mr1253 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008865540 | 9.13E-07 | 6.82E-08 | mr1253 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008865540 | NA | 8.59E-06 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008865540 | NA | 1.11E-06 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008865540 | NA | 5.01E-06 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |