\
| Variant ID: vg1008819475 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8819475 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTATATTTTTGTAAGACGTGGGTCTGTATGTCAACAATTGTCGTTTGTGTACCTTGGCAGGTCCTGGACAGGGATTTAATGCACATTCAGCTTAGAAATT[C/A]
TGATTCGAGAATTTCTGGGTGTGACAAGTTGGTATCAGAGCCGACCTTGACCGTAGGACAAGCCAACTGGAAACCTAAGAGCCCTCTGAACCCTTTTTTT
AAAAAAAGGGTTCAGAGGGCTCTTAGGTTTCCAGTTGGCTTGTCCTACGGTCAAGGTCGGCTCTGATACCAACTTGTCACACCCAGAAATTCTCGAATCA[G/T]
AATTTCTAAGCTGAATGTGCATTAAATCCCTGTCCAGGACCTGCCAAGGTACACAAACGACAATTGTTGACATACAGACCCACGTCTTACAAAAATATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.00% | 13.10% | 0.40% | 21.56% | NA |
| All Indica | 2759 | 95.50% | 1.00% | 0.25% | 3.23% | NA |
| All Japonica | 1512 | 23.70% | 38.10% | 0.33% | 37.90% | NA |
| Aus | 269 | 1.90% | 0.40% | 1.49% | 96.28% | NA |
| Indica I | 595 | 98.00% | 0.50% | 0.00% | 1.51% | NA |
| Indica II | 465 | 97.80% | 1.10% | 0.22% | 0.86% | NA |
| Indica III | 913 | 95.20% | 0.70% | 0.33% | 3.83% | NA |
| Indica Intermediate | 786 | 92.60% | 1.80% | 0.38% | 5.22% | NA |
| Temperate Japonica | 767 | 6.40% | 53.10% | 0.13% | 40.42% | NA |
| Tropical Japonica | 504 | 46.40% | 8.30% | 0.40% | 44.84% | NA |
| Japonica Intermediate | 241 | 31.10% | 52.70% | 0.83% | 15.35% | NA |
| VI/Aromatic | 96 | 25.00% | 0.00% | 3.12% | 71.88% | NA |
| Intermediate | 90 | 53.30% | 14.40% | 0.00% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008819475 | C -> A | LOC_Os10g17489.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.128; most accessible tissue: Minghui63 root, score: 54.099 | N | N | N | N |
| vg1008819475 | C -> DEL | N | N | silent_mutation | Average:23.128; most accessible tissue: Minghui63 root, score: 54.099 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008819475 | NA | 1.56E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008819475 | NA | 1.11E-08 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008819475 | NA | 3.45E-09 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008819475 | NA | 2.09E-07 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008819475 | NA | 9.91E-06 | mr1942_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |