\
| Variant ID: vg1008811441 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 8811441 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 200. )
ATATTGTCAAATCATAGAGCAATTAAGTTTAAAAGATCCGTCTCGCAAATTAGTTACAATCTGTGTAATTAGTTATTTTTTTAGCCTATATTTAATACTT[C/T]
ATATATGTGTTCAAACGTTCAACGGGACAGGGTGAAAATTTTTAAGGTGAGATCTAAATTGGGCCTGAGTAATGGCGACCTCTTAAACTAGTTAGGTGGT
ACCACCTAACTAGTTTAAGAGGTCGCCATTACTCAGGCCCAATTTAGATCTCACCTTAAAAATTTTCACCCTGTCCCGTTGAACGTTTGAACACATATAT[G/A]
AAGTATTAAATATAGGCTAAAAAAATAACTAATTACACAGATTGTAACTAATTTGCGAGACGGATCTTTTAAACTTAATTGCTCTATGATTTGACAATAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.60% | 36.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 61.90% | 38.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.90% | 10.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 40.90% | 59.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 61.00% | 39.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 55.00% | 45.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 56.30% | 43.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1008811441 | C -> T | LOC_Os10g17489.1 | upstream_gene_variant ; 3801.0bp to feature; MODIFIER | silent_mutation | Average:43.164; most accessible tissue: Callus, score: 61.069 | N | N | N | N |
| vg1008811441 | C -> T | LOC_Os10g17470.1 | downstream_gene_variant ; 2896.0bp to feature; MODIFIER | silent_mutation | Average:43.164; most accessible tissue: Callus, score: 61.069 | N | N | N | N |
| vg1008811441 | C -> T | LOC_Os10g17470-LOC_Os10g17489 | intergenic_region ; MODIFIER | silent_mutation | Average:43.164; most accessible tissue: Callus, score: 61.069 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1008811441 | 5.78E-06 | NA | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008811441 | 8.32E-06 | 8.31E-06 | mr1027 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008811441 | NA | 1.68E-08 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008811441 | NA | 3.76E-14 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008811441 | NA | 2.52E-12 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008811441 | 1.61E-06 | NA | mr1027_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008811441 | 4.65E-06 | 2.35E-10 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008811441 | NA | 2.22E-08 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008811441 | NA | 8.46E-07 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008811441 | NA | 7.47E-17 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008811441 | NA | 2.53E-11 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008811441 | NA | 7.15E-08 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1008811441 | NA | 3.60E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |